Incidental Mutation 'R3690:Nav1'
ID269706
Institutional Source Beutler Lab
Gene Symbol Nav1
Ensembl Gene ENSMUSG00000009418
Gene Nameneuron navigator 1
Synonymssteerin-1, C230080M11Rik, unc53H1, 9930003A20Rik, POMFIL3
MMRRC Submission 040685-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R3690 (G1)
Quality Score204
Status Validated
Chromosome1
Chromosomal Location135434580-135607295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135467644 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 996 (I996L)
Ref Sequence ENSEMBL: ENSMUSP00000140322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040599] [ENSMUST00000067414] [ENSMUST00000190298]
Predicted Effect probably benign
Transcript: ENSMUST00000040599
AA Change: I996L

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043803
Gene: ENSMUSG00000009418
AA Change: I996L

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067414
AA Change: I996L

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067241
Gene: ENSMUSG00000009418
AA Change: I996L

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000189252
AA Change: I10L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190130
Predicted Effect probably benign
Transcript: ENSMUST00000190298
AA Change: I996L

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140322
Gene: ENSMUSG00000009418
AA Change: I996L

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1013 1048 N/A INTRINSIC
low complexity region 1122 1153 N/A INTRINSIC
low complexity region 1200 1221 N/A INTRINSIC
low complexity region 1236 1244 N/A INTRINSIC
coiled coil region 1268 1300 N/A INTRINSIC
AAA 1488 1642 3.16e-5 SMART
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,091,329 Y629F probably benign Het
Abcb5 T A 12: 118,872,933 D1081V probably damaging Het
Afdn A G 17: 13,888,409 E1398G probably damaging Het
Atp8b5 T C 4: 43,368,055 C893R probably damaging Het
Avl9 C T 6: 56,736,827 H357Y probably benign Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Btbd19 A T 4: 117,120,592 probably benign Het
Cap1 A G 4: 122,864,626 S254P probably damaging Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cln6 T C 9: 62,846,970 I98T possibly damaging Het
Cul9 T C 17: 46,504,031 probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Ddias G A 7: 92,860,158 P183L probably benign Het
Dnase2b A T 3: 146,593,571 Y42* probably null Het
Dusp16 C T 6: 134,761,119 probably benign Het
Egfr T C 11: 16,871,881 probably benign Het
Fam171a1 T C 2: 3,226,356 V842A probably benign Het
Folr1 T C 7: 101,858,538 S232G probably benign Het
Foxj3 T C 4: 119,616,642 probably benign Het
Fpr-rs6 T C 17: 20,182,875 M75V probably benign Het
Fxyd5 G T 7: 31,036,439 L128M possibly damaging Het
Gigyf2 T C 1: 87,421,516 S500P possibly damaging Het
Inppl1 A G 7: 101,832,068 L268P probably damaging Het
Klk1b24 A T 7: 44,191,819 H192L probably benign Het
Llgl1 T G 11: 60,707,002 Y316D probably damaging Het
Lmbrd1 T A 1: 24,762,293 *143R probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mcm3ap A G 10: 76,482,679 E678G probably damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Neb T C 2: 52,137,385 E6868G probably damaging Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nup50 C T 15: 84,939,793 T449M probably damaging Het
Olfr11 A G 13: 21,639,338 F62L probably damaging Het
Olfr294 G A 7: 86,616,478 P56S probably damaging Het
Olfr612 T C 7: 103,539,067 T56A probably benign Het
Olfr666 T C 7: 104,893,517 Y37C possibly damaging Het
Olfr675 A G 7: 105,024,695 L95P probably damaging Het
Pald1 A T 10: 61,355,808 probably null Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Ric3 A G 7: 109,038,610 V312A possibly damaging Het
Scaper C T 9: 55,883,921 G231D probably benign Het
Smc1b T A 15: 85,117,263 probably benign Het
Smcr8 A G 11: 60,778,028 M1V probably null Het
Smtn T C 11: 3,527,687 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tex47 A G 5: 7,304,777 probably benign Het
Tram2 T A 1: 21,005,600 Y198F probably damaging Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Ube3a A G 7: 59,276,799 K442E probably damaging Het
Vmn2r116 T A 17: 23,384,824 F8I unknown Het
Vmn2r59 A G 7: 42,011,946 F815S possibly damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zfp579 T C 7: 4,994,720 H64R probably damaging Het
Other mutations in Nav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nav1 APN 1 135450630 missense probably damaging 1.00
IGL01455:Nav1 APN 1 135469635 missense probably benign 0.44
IGL01650:Nav1 APN 1 135454760 missense probably damaging 1.00
IGL01872:Nav1 APN 1 135454076 missense probably damaging 1.00
IGL01967:Nav1 APN 1 135537245 missense probably damaging 1.00
IGL02167:Nav1 APN 1 135470961 missense probably damaging 1.00
IGL02278:Nav1 APN 1 135463714 splice site probably benign
IGL02343:Nav1 APN 1 135454752 nonsense probably null
IGL02378:Nav1 APN 1 135469978 missense probably benign 0.02
IGL02554:Nav1 APN 1 135584913 synonymous silent
IGL03148:Nav1 APN 1 135470024 missense possibly damaging 0.94
IGL03286:Nav1 APN 1 135454536 missense probably benign
IGL03372:Nav1 APN 1 135450903 missense probably damaging 0.99
PIT4802001:Nav1 UTSW 1 135452933 missense unknown
R0388:Nav1 UTSW 1 135448917 splice site probably benign
R0390:Nav1 UTSW 1 135449966 missense possibly damaging 0.80
R0395:Nav1 UTSW 1 135532621 nonsense probably null
R0395:Nav1 UTSW 1 135532623 missense probably damaging 0.97
R0416:Nav1 UTSW 1 135471126 missense possibly damaging 0.73
R0463:Nav1 UTSW 1 135452207 missense possibly damaging 0.76
R0538:Nav1 UTSW 1 135464692 splice site probably benign
R0594:Nav1 UTSW 1 135467643 missense possibly damaging 0.74
R0696:Nav1 UTSW 1 135532614 missense probably damaging 0.99
R0699:Nav1 UTSW 1 135452949 missense probably benign 0.00
R0759:Nav1 UTSW 1 135455260 missense possibly damaging 0.73
R1164:Nav1 UTSW 1 135472410 missense probably benign
R1169:Nav1 UTSW 1 135455205 missense probably damaging 1.00
R1401:Nav1 UTSW 1 135460425 missense probably benign 0.20
R1421:Nav1 UTSW 1 135585010 missense probably damaging 1.00
R1642:Nav1 UTSW 1 135452272 missense probably damaging 1.00
R1705:Nav1 UTSW 1 135584599 missense probably damaging 1.00
R1713:Nav1 UTSW 1 135595234 intron probably benign
R1728:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1729:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1730:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1739:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1740:Nav1 UTSW 1 135458389 critical splice donor site probably null
R1762:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1783:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1784:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1785:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1895:Nav1 UTSW 1 135458658 missense probably damaging 1.00
R1896:Nav1 UTSW 1 135460737 missense probably benign 0.00
R1901:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1902:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1925:Nav1 UTSW 1 135607229 utr 5 prime probably benign
R1939:Nav1 UTSW 1 135465898 missense probably damaging 1.00
R1971:Nav1 UTSW 1 135532353 missense probably benign 0.06
R2063:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2066:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2084:Nav1 UTSW 1 135607420 unclassified probably benign
R2090:Nav1 UTSW 1 135607165 utr 5 prime probably benign
R2107:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2110:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2111:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2112:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2136:Nav1 UTSW 1 135454436 missense probably null 0.18
R2268:Nav1 UTSW 1 135472236 nonsense probably null
R2269:Nav1 UTSW 1 135472236 nonsense probably null
R2847:Nav1 UTSW 1 135450644 splice site probably null
R2869:Nav1 UTSW 1 135460757 synonymous silent
R2871:Nav1 UTSW 1 135460757 synonymous silent
R2872:Nav1 UTSW 1 135460757 synonymous silent
R2904:Nav1 UTSW 1 135585238 missense probably benign
R3716:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3717:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3718:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3815:Nav1 UTSW 1 135471124 missense possibly damaging 0.95
R4282:Nav1 UTSW 1 135457913 intron probably benign
R4361:Nav1 UTSW 1 135607437 unclassified probably benign
R4610:Nav1 UTSW 1 135592448 intron probably benign
R4730:Nav1 UTSW 1 135607311 unclassified probably benign
R4784:Nav1 UTSW 1 135458739 missense probably damaging 1.00
R4788:Nav1 UTSW 1 135469723 missense probably benign
R4808:Nav1 UTSW 1 135455204 missense probably damaging 1.00
R4996:Nav1 UTSW 1 135465971 missense probably damaging 1.00
R5284:Nav1 UTSW 1 135449963 nonsense probably null
R5514:Nav1 UTSW 1 135470561 missense probably benign 0.04
R5769:Nav1 UTSW 1 135452257 missense probably damaging 1.00
R5834:Nav1 UTSW 1 135532406 missense probably benign 0.07
R5898:Nav1 UTSW 1 135585146 missense probably benign
R6081:Nav1 UTSW 1 135470822 missense probably damaging 1.00
R6344:Nav1 UTSW 1 135450796 missense probably damaging 1.00
R6378:Nav1 UTSW 1 135454695 missense probably damaging 1.00
R7001:Nav1 UTSW 1 135454611 splice site probably null
R7185:Nav1 UTSW 1 135471008 missense possibly damaging 0.85
R7291:Nav1 UTSW 1 135465859 missense probably damaging 1.00
R7361:Nav1 UTSW 1 135452853 missense unknown
R7390:Nav1 UTSW 1 135584918 missense probably benign 0.01
R7464:Nav1 UTSW 1 135584909 missense probably benign 0.03
R7502:Nav1 UTSW 1 135469666 missense probably damaging 1.00
R7601:Nav1 UTSW 1 135460438 missense unknown
R7625:Nav1 UTSW 1 135467745 missense probably damaging 1.00
R7639:Nav1 UTSW 1 135471122 missense probably benign 0.09
R7786:Nav1 UTSW 1 135469995 missense probably damaging 1.00
R7808:Nav1 UTSW 1 135452248 missense unknown
R7815:Nav1 UTSW 1 135584639 missense possibly damaging 0.49
R7825:Nav1 UTSW 1 135450044 missense probably damaging 0.98
R8030:Nav1 UTSW 1 135537239 missense probably damaging 1.00
R8370:Nav1 UTSW 1 135471144 nonsense probably null
R8405:Nav1 UTSW 1 135454770 missense unknown
Z1088:Nav1 UTSW 1 135470724 missense probably benign 0.01
Z1176:Nav1 UTSW 1 135452886 missense unknown
Z1176:Nav1 UTSW 1 135472420 missense probably damaging 1.00
Z1177:Nav1 UTSW 1 135469731 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CCATCAGGACCCTATAGCTGTG -3'
(R):5'- CAGCTCAGACTGTGTCTCTTTG -3'

Sequencing Primer
(F):5'- GGGACAACCTTTTAGTCTAAGACC -3'
(R):5'- GCTACTTCTTCAGGTACCAGC -3'
Posted On2015-02-19