Mutagenetix > Incidental Mutations

Incidental Mutation 'R3690:Pde11a'

269709

Institutional Source

Beutler Lab

Gene Symbol

Pde11a

Ensembl Gene

ENSMUSG00000075270

Gene Name

phosphodiesterase 11A

Synonyms

A630086N24Rik, 6330414F14Rik

MMRRC Submission

040685-MU

Accession Numbers

Genbank: NM_001081033; MGI: 3036251

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R3690 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75989141-76338774 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76291166 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Isoleucine at position 357 (K357I)

Ref Sequence

ENSEMBL: ENSMUSP00000097572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099992]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099992
AA Change: K357I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097572
Gene: ENSMUSG00000075270
AA Change: K357I

Domain	Start	End	E-Value	Type
low complexity region	68	82	N/A	INTRINSIC
low complexity region	149	164	N/A	INTRINSIC
GAF	217	380	1.79e-30	SMART
GAF	402	568	2.34e-25	SMART
HDc	661	830	7.75e-6	SMART

Meta Mutation Damage Score

0.2688

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a member of the PDE protein superfamily. Mutations in this gene are a cause of Cushing disease and adrenocortical hyperplasia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have enlarged lateral ventricles and exhibit abnormal behavior. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	A	6: 23,091,329	Y629F	probably benign	Het
Abcb5	T	A	12: 118,872,933	D1081V	probably damaging	Het
Afdn	A	G	17: 13,888,409	E1398G	probably damaging	Het
Atp8b5	T	C	4: 43,368,055	C893R	probably damaging	Het
Avl9	C	T	6: 56,736,827	H357Y	probably benign	Het
Bclaf1	C	T	10: 20,325,397	T423I	possibly damaging	Het
Btbd19	A	T	4: 117,120,592		probably benign	Het
Cap1	A	G	4: 122,864,626	S254P	probably damaging	Het
Cdc42ep1	T	C	15: 78,847,429	S25P	probably benign	Het
Cln6	T	C	9: 62,846,970	I98T	possibly damaging	Het
Cul9	T	C	17: 46,504,031		probably null	Het
Dcx	T	C	X: 143,877,244	E268G	possibly damaging	Het
Ddias	G	A	7: 92,860,158	P183L	probably benign	Het
Dnase2b	A	T	3: 146,593,571	Y42*	probably null	Het
Dusp16	C	T	6: 134,761,119		probably benign	Het
Egfr	T	C	11: 16,871,881		probably benign	Het
Fam171a1	T	C	2: 3,226,356	V842A	probably benign	Het
Folr1	T	C	7: 101,858,538	S232G	probably benign	Het
Foxj3	T	C	4: 119,616,642		probably benign	Het
Fpr-rs6	T	C	17: 20,182,875	M75V	probably benign	Het
Fxyd5	G	T	7: 31,036,439	L128M	possibly damaging	Het
Gigyf2	T	C	1: 87,421,516	S500P	possibly damaging	Het
Inppl1	A	G	7: 101,832,068	L268P	probably damaging	Het
Klk1b24	A	T	7: 44,191,819	H192L	probably benign	Het
Llgl1	T	G	11: 60,707,002	Y316D	probably damaging	Het
Lmbrd1	T	A	1: 24,762,293	*143R	probably null	Het
Map3k15	T	A	X: 160,122,572	N1295K	possibly damaging	Het
Mcm3ap	A	G	10: 76,482,679	E678G	probably damaging	Het
Mrpl44	T	A	1: 79,779,649	Y270*	probably null	Het
Nav1	T	A	1: 135,467,644	I996L	probably benign	Het
Neb	T	C	2: 52,137,385	E6868G	probably damaging	Het
Nexmif	A	T	X: 104,087,607	Y235N	probably damaging	Het
Nup50	C	T	15: 84,939,793	T449M	probably damaging	Het
Olfr11	A	G	13: 21,639,338	F62L	probably damaging	Het
Olfr294	G	A	7: 86,616,478	P56S	probably damaging	Het
Olfr612	T	C	7: 103,539,067	T56A	probably benign	Het
Olfr666	T	C	7: 104,893,517	Y37C	possibly damaging	Het
Olfr675	A	G	7: 105,024,695	L95P	probably damaging	Het
Pald1	A	T	10: 61,355,808		probably null	Het
Ric3	A	G	7: 109,038,610	V312A	possibly damaging	Het
Scaper	C	T	9: 55,883,921	G231D	probably benign	Het
Smc1b	T	A	15: 85,117,263		probably benign	Het
Smcr8	A	G	11: 60,778,028	M1V	probably null	Het
Smtn	T	C	11: 3,527,687		probably benign	Het
Spatc1	A	T	15: 76,268,295	K42*	probably null	Het
Taf7l	A	T	X: 134,464,325	I449K	probably damaging	Het
Tex47	A	G	5: 7,304,777		probably benign	Het
Tram2	T	A	1: 21,005,600	Y198F	probably damaging	Het
Ttn	C	G	2: 76,799,244	W14284C	probably damaging	Het
Ube3a	A	G	7: 59,276,799	K442E	probably damaging	Het
Vmn2r116	T	A	17: 23,384,824	F8I	unknown	Het
Vmn2r59	A	G	7: 42,011,946	F815S	possibly damaging	Het
Zap70	T	C	1: 36,781,412	C563R	probably damaging	Het
Zfp579	T	C	7: 4,994,720	H64R	probably damaging	Het

Other mutations in Pde11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Pde11a	APN	2	76215385	missense	probably damaging	1.00
IGL01528:Pde11a	APN	2	76194956	splice site	probably benign
IGL02117:Pde11a	APN	2	75991262	missense	probably damaging	1.00
IGL02428:Pde11a	APN	2	76046845	missense	possibly damaging	0.68
IGL02455:Pde11a	APN	2	76158393	missense	possibly damaging	0.58
IGL02731:Pde11a	APN	2	75991239	missense	probably benign	0.00
IGL03068:Pde11a	APN	2	76017864	missense	probably damaging	1.00
IGL03081:Pde11a	APN	2	76075930	splice site	probably benign
D4186:Pde11a	UTSW	2	76291290	missense	probably damaging	1.00
R0323:Pde11a	UTSW	2	76046774	splice site	probably null
R0433:Pde11a	UTSW	2	76337706	missense	possibly damaging	0.47
R1226:Pde11a	UTSW	2	76158354	missense	probably benign	0.10
R1542:Pde11a	UTSW	2	76046855	missense	probably benign	0.25
R1941:Pde11a	UTSW	2	76291250	missense	probably benign	0.10
R2107:Pde11a	UTSW	2	76337922	missense	probably damaging	1.00
R2394:Pde11a	UTSW	2	76059061	missense	probably benign	0.00
R3689:Pde11a	UTSW	2	76291166	missense	probably damaging	1.00
R3945:Pde11a	UTSW	2	76075931	splice site	probably benign
R4073:Pde11a	UTSW	2	76337898	missense	probably damaging	1.00
R4074:Pde11a	UTSW	2	76337898	missense	probably damaging	1.00
R4588:Pde11a	UTSW	2	76029303	missense	probably damaging	1.00
R4602:Pde11a	UTSW	2	76158333	missense	probably benign	0.05
R4604:Pde11a	UTSW	2	76337793	missense	possibly damaging	0.89
R4609:Pde11a	UTSW	2	76291241	missense	possibly damaging	0.94
R4610:Pde11a	UTSW	2	76158333	missense	probably benign	0.05
R5017:Pde11a	UTSW	2	76136367	missense	probably benign	0.05
R5519:Pde11a	UTSW	2	76075955	missense	probably damaging	1.00
R5930:Pde11a	UTSW	2	76139831	splice site	probably null
R6000:Pde11a	UTSW	2	76017860	missense	probably damaging	0.98
R6018:Pde11a	UTSW	2	76017850	missense	probably benign	0.00
R6913:Pde11a	UTSW	2	76337740	missense	probably damaging	1.00
R7117:Pde11a	UTSW	2	76076004	missense	probably damaging	1.00
R7258:Pde11a	UTSW	2	76139906	missense	possibly damaging	0.91
R7267:Pde11a	UTSW	2	76337845	missense	probably damaging	1.00
R7409:Pde11a	UTSW	2	76005984	missense
R7451:Pde11a	UTSW	2	76022773	missense	possibly damaging	0.89
R7452:Pde11a	UTSW	2	76136414	missense	probably damaging	1.00
R7598:Pde11a	UTSW	2	76136423	missense	probably damaging	1.00
R7671:Pde11a	UTSW	2	76215353	missense	possibly damaging	0.81
R7886:Pde11a	UTSW	2	76291203	missense	probably benign
R8045:Pde11a	UTSW	2	76022728	missense	probably damaging	0.99
R8137:Pde11a	UTSW	2	76211039	missense	possibly damaging	0.91
R8420:Pde11a	UTSW	2	76059010	missense	probably damaging	1.00
Z1176:Pde11a	UTSW	2	76194905	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGACTGATTATGTCCAATTATACCCC -3'
(R):5'- GCCCTTGAAATGAATGCTTTCTG -3'

Sequencing Primer
(F):5'- AGGCCTCCATTACATCTAGG -3'
(R):5'- TTCTGTCTTATTTTTAGGACCGAAG -3'

Posted On

2015-02-19