Incidental Mutation 'R3690:Foxj3'
ID269715
Institutional Source Beutler Lab
Gene Symbol Foxj3
Ensembl Gene ENSMUSG00000032998
Gene Nameforkhead box J3
SynonymsC330039G02Rik, Fhd6
MMRRC Submission 040685-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R3690 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location119537004-119629119 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 119616642 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044564] [ENSMUST00000106310]
Predicted Effect probably benign
Transcript: ENSMUST00000044564
SMART Domains Protein: ENSMUSP00000035746
Gene: ENSMUSG00000032998

DomainStartEndE-ValueType
FH 76 164 6.03e-50 SMART
low complexity region 226 239 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 317 346 N/A INTRINSIC
low complexity region 372 434 N/A INTRINSIC
low complexity region 611 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106310
SMART Domains Protein: ENSMUSP00000101917
Gene: ENSMUSG00000032998

DomainStartEndE-ValueType
FH 76 164 6.03e-50 SMART
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 283 312 N/A INTRINSIC
low complexity region 338 400 N/A INTRINSIC
low complexity region 577 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133097
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygous null mice have an abnormal skeletal muscle fiber type ratio in males as well as defects in muscle regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,091,329 Y629F probably benign Het
Abcb5 T A 12: 118,872,933 D1081V probably damaging Het
Afdn A G 17: 13,888,409 E1398G probably damaging Het
Atp8b5 T C 4: 43,368,055 C893R probably damaging Het
Avl9 C T 6: 56,736,827 H357Y probably benign Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Btbd19 A T 4: 117,120,592 probably benign Het
Cap1 A G 4: 122,864,626 S254P probably damaging Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cln6 T C 9: 62,846,970 I98T possibly damaging Het
Cul9 T C 17: 46,504,031 probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Ddias G A 7: 92,860,158 P183L probably benign Het
Dnase2b A T 3: 146,593,571 Y42* probably null Het
Dusp16 C T 6: 134,761,119 probably benign Het
Egfr T C 11: 16,871,881 probably benign Het
Fam171a1 T C 2: 3,226,356 V842A probably benign Het
Folr1 T C 7: 101,858,538 S232G probably benign Het
Fpr-rs6 T C 17: 20,182,875 M75V probably benign Het
Fxyd5 G T 7: 31,036,439 L128M possibly damaging Het
Gigyf2 T C 1: 87,421,516 S500P possibly damaging Het
Inppl1 A G 7: 101,832,068 L268P probably damaging Het
Klk1b24 A T 7: 44,191,819 H192L probably benign Het
Llgl1 T G 11: 60,707,002 Y316D probably damaging Het
Lmbrd1 T A 1: 24,762,293 *143R probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mcm3ap A G 10: 76,482,679 E678G probably damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Nav1 T A 1: 135,467,644 I996L probably benign Het
Neb T C 2: 52,137,385 E6868G probably damaging Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nup50 C T 15: 84,939,793 T449M probably damaging Het
Olfr11 A G 13: 21,639,338 F62L probably damaging Het
Olfr294 G A 7: 86,616,478 P56S probably damaging Het
Olfr612 T C 7: 103,539,067 T56A probably benign Het
Olfr666 T C 7: 104,893,517 Y37C possibly damaging Het
Olfr675 A G 7: 105,024,695 L95P probably damaging Het
Pald1 A T 10: 61,355,808 probably null Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Ric3 A G 7: 109,038,610 V312A possibly damaging Het
Scaper C T 9: 55,883,921 G231D probably benign Het
Smc1b T A 15: 85,117,263 probably benign Het
Smcr8 A G 11: 60,778,028 M1V probably null Het
Smtn T C 11: 3,527,687 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tex47 A G 5: 7,304,777 probably benign Het
Tram2 T A 1: 21,005,600 Y198F probably damaging Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Ube3a A G 7: 59,276,799 K442E probably damaging Het
Vmn2r116 T A 17: 23,384,824 F8I unknown Het
Vmn2r59 A G 7: 42,011,946 F815S possibly damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zfp579 T C 7: 4,994,720 H64R probably damaging Het
Other mutations in Foxj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Foxj3 APN 4 119610029 missense probably benign 0.03
IGL01452:Foxj3 APN 4 119621628 missense unknown
IGL02056:Foxj3 APN 4 119585757 missense probably damaging 1.00
IGL02455:Foxj3 APN 4 119620237 missense unknown
IGL02542:Foxj3 APN 4 119620343 missense unknown
IGL02625:Foxj3 APN 4 119624917 missense unknown
IGL03216:Foxj3 APN 4 119609983 intron probably benign
R0087:Foxj3 UTSW 4 119626400 missense unknown
R0488:Foxj3 UTSW 4 119619990 nonsense probably null
R0512:Foxj3 UTSW 4 119585836 splice site probably benign
R1531:Foxj3 UTSW 4 119620201 missense unknown
R1799:Foxj3 UTSW 4 119619351 missense probably benign 0.06
R1883:Foxj3 UTSW 4 119610029 missense probably benign 0.20
R3691:Foxj3 UTSW 4 119616642 splice site probably benign
R3838:Foxj3 UTSW 4 119616624 missense possibly damaging 0.49
R4065:Foxj3 UTSW 4 119610009 missense probably benign 0.09
R4295:Foxj3 UTSW 4 119626297 nonsense probably null
R4576:Foxj3 UTSW 4 119621663 missense unknown
R4750:Foxj3 UTSW 4 119616590 missense probably damaging 0.99
R4782:Foxj3 UTSW 4 119621660 missense unknown
R4799:Foxj3 UTSW 4 119621660 missense unknown
R5305:Foxj3 UTSW 4 119619958 missense possibly damaging 0.73
R5358:Foxj3 UTSW 4 119619399 missense probably damaging 1.00
R5362:Foxj3 UTSW 4 119620143 missense unknown
R5728:Foxj3 UTSW 4 119573762 missense probably damaging 1.00
R5732:Foxj3 UTSW 4 119585811 missense probably damaging 1.00
R6151:Foxj3 UTSW 4 119623271 missense unknown
R6352:Foxj3 UTSW 4 119585778 missense probably damaging 1.00
R6377:Foxj3 UTSW 4 119573748 splice site probably null
R7034:Foxj3 UTSW 4 119619300 missense probably damaging 0.97
R7672:Foxj3 UTSW 4 119620232 missense unknown
R7912:Foxj3 UTSW 4 119620055 missense possibly damaging 0.63
R8215:Foxj3 UTSW 4 119621611 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGTACTGAGGGCCTGTT -3'
(R):5'- TGCTTTATGGACTCAATTGATTAGTG -3'

Sequencing Primer
(F):5'- ACTGAGGGCCTGTTGTACTTTCC -3'
(R):5'- GTGTGACCCATCCAATAGCTG -3'
Posted On2015-02-19