Incidental Mutation 'R3690:Dusp16'
ID269720
Institutional Source Beutler Lab
Gene Symbol Dusp16
Ensembl Gene ENSMUSG00000030203
Gene Namedual specificity phosphatase 16
Synonyms3830417M17Rik, D6Ertd213e, MKP7, MKP-7
MMRRC Submission 040685-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock #R3690 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location134715468-134792625 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 134761119 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100857] [ENSMUST00000129433] [ENSMUST00000149776] [ENSMUST00000204083]
Predicted Effect probably benign
Transcript: ENSMUST00000100857
SMART Domains Protein: ENSMUSP00000098419
Gene: ENSMUSG00000030203

DomainStartEndE-ValueType
RHOD 12 134 5.58e-16 SMART
DSPc 158 297 1.66e-68 SMART
Blast:DSPc 576 621 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129433
SMART Domains Protein: ENSMUSP00000115925
Gene: ENSMUSG00000030203

DomainStartEndE-ValueType
Blast:RHOD 1 67 8e-41 BLAST
PDB:2VSW|B 1 83 1e-52 PDB
DSPc 91 232 3.73e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148926
Predicted Effect probably benign
Transcript: ENSMUST00000149776
SMART Domains Protein: ENSMUSP00000144784
Gene: ENSMUSG00000030203

DomainStartEndE-ValueType
RHOD 12 134 5.58e-16 SMART
Blast:DSPc 158 203 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204083
SMART Domains Protein: ENSMUSP00000144834
Gene: ENSMUSG00000030203

DomainStartEndE-ValueType
RHOD 12 124 1.5e-8 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitogen-activated protein kinase phosphatase that is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. The encoded protein specifically regulates the c-Jun amino-terminal kinase (JNK) and extracellular signal-regulated kinase (ERK) pathways.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality and decreased birth weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,091,329 Y629F probably benign Het
Abcb5 T A 12: 118,872,933 D1081V probably damaging Het
Afdn A G 17: 13,888,409 E1398G probably damaging Het
Atp8b5 T C 4: 43,368,055 C893R probably damaging Het
Avl9 C T 6: 56,736,827 H357Y probably benign Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Btbd19 A T 4: 117,120,592 probably benign Het
Cap1 A G 4: 122,864,626 S254P probably damaging Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cln6 T C 9: 62,846,970 I98T possibly damaging Het
Cul9 T C 17: 46,504,031 probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Ddias G A 7: 92,860,158 P183L probably benign Het
Dnase2b A T 3: 146,593,571 Y42* probably null Het
Egfr T C 11: 16,871,881 probably benign Het
Fam171a1 T C 2: 3,226,356 V842A probably benign Het
Folr1 T C 7: 101,858,538 S232G probably benign Het
Foxj3 T C 4: 119,616,642 probably benign Het
Fpr-rs6 T C 17: 20,182,875 M75V probably benign Het
Fxyd5 G T 7: 31,036,439 L128M possibly damaging Het
Gigyf2 T C 1: 87,421,516 S500P possibly damaging Het
Inppl1 A G 7: 101,832,068 L268P probably damaging Het
Klk1b24 A T 7: 44,191,819 H192L probably benign Het
Llgl1 T G 11: 60,707,002 Y316D probably damaging Het
Lmbrd1 T A 1: 24,762,293 *143R probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mcm3ap A G 10: 76,482,679 E678G probably damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Nav1 T A 1: 135,467,644 I996L probably benign Het
Neb T C 2: 52,137,385 E6868G probably damaging Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nup50 C T 15: 84,939,793 T449M probably damaging Het
Olfr11 A G 13: 21,639,338 F62L probably damaging Het
Olfr294 G A 7: 86,616,478 P56S probably damaging Het
Olfr612 T C 7: 103,539,067 T56A probably benign Het
Olfr666 T C 7: 104,893,517 Y37C possibly damaging Het
Olfr675 A G 7: 105,024,695 L95P probably damaging Het
Pald1 A T 10: 61,355,808 probably null Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Ric3 A G 7: 109,038,610 V312A possibly damaging Het
Scaper C T 9: 55,883,921 G231D probably benign Het
Smc1b T A 15: 85,117,263 probably benign Het
Smcr8 A G 11: 60,778,028 M1V probably null Het
Smtn T C 11: 3,527,687 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tex47 A G 5: 7,304,777 probably benign Het
Tram2 T A 1: 21,005,600 Y198F probably damaging Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Ube3a A G 7: 59,276,799 K442E probably damaging Het
Vmn2r116 T A 17: 23,384,824 F8I unknown Het
Vmn2r59 A G 7: 42,011,946 F815S possibly damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zfp579 T C 7: 4,994,720 H64R probably damaging Het
Other mutations in Dusp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Dusp16 APN 6 134725949 missense probably benign 0.13
IGL01305:Dusp16 APN 6 134718861 missense probably benign 0.03
IGL01331:Dusp16 APN 6 134718104 missense possibly damaging 0.53
IGL02535:Dusp16 APN 6 134718827 missense probably benign
IGL02606:Dusp16 APN 6 134761036 missense probably damaging 0.96
IGL02696:Dusp16 APN 6 134718435 missense probably damaging 0.99
ANU22:Dusp16 UTSW 6 134718861 missense probably benign 0.03
PIT4469001:Dusp16 UTSW 6 134761152 unclassified probably benign
PIT4504001:Dusp16 UTSW 6 134739883 missense possibly damaging 0.90
R0492:Dusp16 UTSW 6 134718402 missense probably benign
R0578:Dusp16 UTSW 6 134718321 missense probably damaging 1.00
R1630:Dusp16 UTSW 6 134720561 missense probably damaging 1.00
R1962:Dusp16 UTSW 6 134718136 nonsense probably null
R2004:Dusp16 UTSW 6 134718839 missense probably benign
R3730:Dusp16 UTSW 6 134718861 missense probably benign
R5778:Dusp16 UTSW 6 134718314 missense probably benign 0.01
R6267:Dusp16 UTSW 6 134720493 critical splice donor site probably null
R6296:Dusp16 UTSW 6 134720493 critical splice donor site probably null
R6860:Dusp16 UTSW 6 134725879 nonsense probably null
R7248:Dusp16 UTSW 6 134718977 missense probably benign 0.01
R7645:Dusp16 UTSW 6 134725925 missense probably damaging 0.97
R8108:Dusp16 UTSW 6 134739873 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCGCTTCATCAGTTTGGAG -3'
(R):5'- GCTGCTTTGTGGAAGGAATC -3'

Sequencing Primer
(F):5'- TGGCTTCCAAAATGTGAGACG -3'
(R):5'- GAAGGAATCCTTTGCAAGAGCATATC -3'
Posted On2015-02-19