Incidental Mutation 'R3690:Olfr675'
ID 269732
Institutional Source Beutler Lab
Gene Symbol Olfr675
Ensembl Gene ENSMUSG00000096773
Gene Name olfactory receptor 675
Synonyms GA_x6K02T2PBJ9-7653782-7652841, MOR32-9P
MMRRC Submission 040685-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R3690 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 105021370-105028460 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105024695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 95 (L95P)
Ref Sequence ENSEMBL: ENSMUSP00000149895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073102] [ENSMUST00000210113] [ENSMUST00000214318] [ENSMUST00000215899]
AlphaFold A0A1B0GSE1
Predicted Effect probably damaging
Transcript: ENSMUST00000073102
AA Change: L91P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072847
Gene: ENSMUSG00000096773
AA Change: L91P

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 5e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.9e-6 PFAM
Pfam:7tm_1 43 293 2.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210113
AA Change: L95P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214318
AA Change: L95P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215899
AA Change: L95P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,091,329 Y629F probably benign Het
Abcb5 T A 12: 118,872,933 D1081V probably damaging Het
Afdn A G 17: 13,888,409 E1398G probably damaging Het
Atp8b5 T C 4: 43,368,055 C893R probably damaging Het
Avl9 C T 6: 56,736,827 H357Y probably benign Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Btbd19 A T 4: 117,120,592 probably benign Het
Cap1 A G 4: 122,864,626 S254P probably damaging Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cln6 T C 9: 62,846,970 I98T possibly damaging Het
Cul9 T C 17: 46,504,031 probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Ddias G A 7: 92,860,158 P183L probably benign Het
Dnase2b A T 3: 146,593,571 Y42* probably null Het
Dusp16 C T 6: 134,761,119 probably benign Het
Egfr T C 11: 16,871,881 probably benign Het
Fam171a1 T C 2: 3,226,356 V842A probably benign Het
Folr1 T C 7: 101,858,538 S232G probably benign Het
Foxj3 T C 4: 119,616,642 probably benign Het
Fpr-rs6 T C 17: 20,182,875 M75V probably benign Het
Fxyd5 G T 7: 31,036,439 L128M possibly damaging Het
Gigyf2 T C 1: 87,421,516 S500P possibly damaging Het
Inppl1 A G 7: 101,832,068 L268P probably damaging Het
Klk1b24 A T 7: 44,191,819 H192L probably benign Het
Llgl1 T G 11: 60,707,002 Y316D probably damaging Het
Lmbrd1 T A 1: 24,762,293 *143R probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mcm3ap A G 10: 76,482,679 E678G probably damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Nav1 T A 1: 135,467,644 I996L probably benign Het
Neb T C 2: 52,137,385 E6868G probably damaging Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nup50 C T 15: 84,939,793 T449M probably damaging Het
Olfr11 A G 13: 21,639,338 F62L probably damaging Het
Olfr294 G A 7: 86,616,478 P56S probably damaging Het
Olfr612 T C 7: 103,539,067 T56A probably benign Het
Olfr666 T C 7: 104,893,517 Y37C possibly damaging Het
Pald1 A T 10: 61,355,808 probably null Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Ric3 A G 7: 109,038,610 V312A possibly damaging Het
Scaper C T 9: 55,883,921 G231D probably benign Het
Smc1b T A 15: 85,117,263 probably benign Het
Smcr8 A G 11: 60,778,028 M1V probably null Het
Smtn T C 11: 3,527,687 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tex47 A G 5: 7,304,777 probably benign Het
Tram2 T A 1: 21,005,600 Y198F probably damaging Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Ube3a A G 7: 59,276,799 K442E probably damaging Het
Vmn2r116 T A 17: 23,384,824 F8I unknown Het
Vmn2r59 A G 7: 42,011,946 F815S possibly damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zfp579 T C 7: 4,994,720 H64R probably damaging Het
Other mutations in Olfr675
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02639:Olfr675 APN 7 105024222 missense probably damaging 1.00
IGL02944:Olfr675 APN 7 105024923 missense probably damaging 1.00
R1182:Olfr675 UTSW 7 105024078 missense probably damaging 1.00
R1412:Olfr675 UTSW 7 105024195 missense probably damaging 1.00
R1528:Olfr675 UTSW 7 105024764 missense probably damaging 1.00
R1555:Olfr675 UTSW 7 105024522 missense probably benign 0.00
R1589:Olfr675 UTSW 7 105024560 missense probably benign
R1778:Olfr675 UTSW 7 105024163 missense probably benign 0.03
R3848:Olfr675 UTSW 7 105024332 missense probably damaging 0.99
R4784:Olfr675 UTSW 7 105024530 missense probably damaging 0.97
R5050:Olfr675 UTSW 7 105024387 missense probably damaging 1.00
R5074:Olfr675 UTSW 7 105024053 missense probably benign
R5499:Olfr675 UTSW 7 105024977 start codon destroyed probably null 0.06
R5586:Olfr675 UTSW 7 105024221 missense probably damaging 1.00
R7244:Olfr675 UTSW 7 105024941 missense probably benign
R8297:Olfr675 UTSW 7 105024678 missense probably benign 0.14
R8532:Olfr675 UTSW 7 105024566 missense probably damaging 1.00
R9087:Olfr675 UTSW 7 105024703 nonsense probably null
Z1176:Olfr675 UTSW 7 105024099 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGTATAGGCTCCTCAGC -3'
(R):5'- GCACACATCTGGATTGGATTTCC -3'

Sequencing Primer
(F):5'- TCCTCAGCACAGCAATACCTG -3'
(R):5'- ACATCTGGATTGGATTTCCCTTTTG -3'
Posted On 2015-02-19