Incidental Mutation 'R3690:Egfr'
ID269739
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Nameepidermal growth factor receptor
Synonymsavian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1
MMRRC Submission 040685-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R3690 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location16752203-16918158 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 16871881 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884]
Predicted Effect probably benign
Transcript: ENSMUST00000020329
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102884
SMART Domains Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 5e-33 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 2e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.54e0 SMART
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,091,329 Y629F probably benign Het
Abcb5 T A 12: 118,872,933 D1081V probably damaging Het
Afdn A G 17: 13,888,409 E1398G probably damaging Het
Atp8b5 T C 4: 43,368,055 C893R probably damaging Het
Avl9 C T 6: 56,736,827 H357Y probably benign Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Btbd19 A T 4: 117,120,592 probably benign Het
Cap1 A G 4: 122,864,626 S254P probably damaging Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cln6 T C 9: 62,846,970 I98T possibly damaging Het
Cul9 T C 17: 46,504,031 probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Ddias G A 7: 92,860,158 P183L probably benign Het
Dnase2b A T 3: 146,593,571 Y42* probably null Het
Dusp16 C T 6: 134,761,119 probably benign Het
Fam171a1 T C 2: 3,226,356 V842A probably benign Het
Folr1 T C 7: 101,858,538 S232G probably benign Het
Foxj3 T C 4: 119,616,642 probably benign Het
Fpr-rs6 T C 17: 20,182,875 M75V probably benign Het
Fxyd5 G T 7: 31,036,439 L128M possibly damaging Het
Gigyf2 T C 1: 87,421,516 S500P possibly damaging Het
Inppl1 A G 7: 101,832,068 L268P probably damaging Het
Klk1b24 A T 7: 44,191,819 H192L probably benign Het
Llgl1 T G 11: 60,707,002 Y316D probably damaging Het
Lmbrd1 T A 1: 24,762,293 *143R probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mcm3ap A G 10: 76,482,679 E678G probably damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Nav1 T A 1: 135,467,644 I996L probably benign Het
Neb T C 2: 52,137,385 E6868G probably damaging Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nup50 C T 15: 84,939,793 T449M probably damaging Het
Olfr11 A G 13: 21,639,338 F62L probably damaging Het
Olfr294 G A 7: 86,616,478 P56S probably damaging Het
Olfr612 T C 7: 103,539,067 T56A probably benign Het
Olfr666 T C 7: 104,893,517 Y37C possibly damaging Het
Olfr675 A G 7: 105,024,695 L95P probably damaging Het
Pald1 A T 10: 61,355,808 probably null Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Ric3 A G 7: 109,038,610 V312A possibly damaging Het
Scaper C T 9: 55,883,921 G231D probably benign Het
Smc1b T A 15: 85,117,263 probably benign Het
Smcr8 A G 11: 60,778,028 M1V probably null Het
Smtn T C 11: 3,527,687 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tex47 A G 5: 7,304,777 probably benign Het
Tram2 T A 1: 21,005,600 Y198F probably damaging Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Ube3a A G 7: 59,276,799 K442E probably damaging Het
Vmn2r116 T A 17: 23,384,824 F8I unknown Het
Vmn2r59 A G 7: 42,011,946 F815S possibly damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zfp579 T C 7: 4,994,720 H64R probably damaging Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16863020 missense probably damaging 1.00
IGL01529:Egfr APN 11 16863014 missense probably benign
IGL01556:Egfr APN 11 16905382 missense probably damaging 1.00
IGL02627:Egfr APN 11 16869346 missense probably damaging 1.00
IGL02862:Egfr APN 11 16883562 missense probably benign 0.25
IGL02945:Egfr APN 11 16752514 missense probably damaging 1.00
IGL02994:Egfr APN 11 16911811 missense probably damaging 1.00
IGL03395:Egfr APN 11 16910261 splice site probably benign
set UTSW 11 16871881 splice site probably benign
Velvet UTSW 11 16904399 missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16910214 missense probably benign 0.00
R0196:Egfr UTSW 11 16911746 missense probably benign 0.02
R0513:Egfr UTSW 11 16872855 missense probably damaging 1.00
R0567:Egfr UTSW 11 16872873 missense probably benign 0.01
R0629:Egfr UTSW 11 16869333 missense probably damaging 1.00
R0961:Egfr UTSW 11 16862964 missense probably damaging 1.00
R1163:Egfr UTSW 11 16883546 missense probably benign 0.02
R1454:Egfr UTSW 11 16889920 missense probably benign
R1456:Egfr UTSW 11 16863065 missense probably benign 0.00
R1503:Egfr UTSW 11 16869301 missense possibly damaging 0.86
R1577:Egfr UTSW 11 16869241 missense probably benign 0.04
R1595:Egfr UTSW 11 16906847 missense probably damaging 0.99
R1699:Egfr UTSW 11 16859019 missense probably benign 0.14
R2172:Egfr UTSW 11 16911562 missense probably benign 0.00
R3922:Egfr UTSW 11 16881495 missense probably damaging 1.00
R4444:Egfr UTSW 11 16871027 missense probably benign 0.00
R4685:Egfr UTSW 11 16858980 missense probably damaging 1.00
R4737:Egfr UTSW 11 16869231 missense probably damaging 0.99
R4814:Egfr UTSW 11 16869354 missense probably damaging 1.00
R4841:Egfr UTSW 11 16911607 missense probably benign 0.05
R4842:Egfr UTSW 11 16911607 missense probably benign 0.05
R4903:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4964:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4985:Egfr UTSW 11 16859029 nonsense probably null
R4998:Egfr UTSW 11 16881493 missense possibly damaging 0.58
R5001:Egfr UTSW 11 16904434 missense probably damaging 0.98
R5304:Egfr UTSW 11 16884260 missense probably benign
R5309:Egfr UTSW 11 16911703 missense probably benign 0.00
R5653:Egfr UTSW 11 16911617 missense probably benign 0.04
R5905:Egfr UTSW 11 16911494 missense probably damaging 1.00
R6051:Egfr UTSW 11 16883607 missense possibly damaging 0.87
R6052:Egfr UTSW 11 16911554 missense probably benign 0.16
R6114:Egfr UTSW 11 16904374 missense possibly damaging 0.46
R6261:Egfr UTSW 11 16889964 missense probably benign 0.11
R6434:Egfr UTSW 11 16869294 missense probably benign 0.25
R6475:Egfr UTSW 11 16891259 missense probably benign
R6799:Egfr UTSW 11 16896952 missense probably damaging 1.00
R7143:Egfr UTSW 11 16871627 missense probably benign 0.20
R7195:Egfr UTSW 11 16868162 missense probably damaging 1.00
R7459:Egfr UTSW 11 16896967 missense probably damaging 1.00
R7612:Egfr UTSW 11 16859025 missense possibly damaging 0.74
R7757:Egfr UTSW 11 16889966 missense possibly damaging 0.64
R7763:Egfr UTSW 11 16891266 missense probably damaging 1.00
R8315:Egfr UTSW 11 16875027 missense probably benign 0.08
R8320:Egfr UTSW 11 16891251 missense probably damaging 1.00
R8324:Egfr UTSW 11 16858971 missense probably damaging 0.99
R8324:Egfr UTSW 11 16908885 missense probably damaging 0.98
R8347:Egfr UTSW 11 16878174 missense probably damaging 1.00
R8511:Egfr UTSW 11 16896949 missense probably damaging 1.00
Z1177:Egfr UTSW 11 16862954 missense probably benign 0.05
Z1177:Egfr UTSW 11 16869319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTGCACTGCCATCAGC -3'
(R):5'- CCGTGGCTTAAAGTGCTTTC -3'

Sequencing Primer
(F):5'- CCTTTAAGGGGTGAGTAACAGCTG -3'
(R):5'- TCAATTTGCATCAAGGGAAACTGG -3'
Posted On2015-02-19