Incidental Mutation 'R3690:Spatc1'
ID269745
Institutional Source Beutler Lab
Gene Symbol Spatc1
Ensembl Gene ENSMUSG00000049653
Gene Namespermatogenesis and centriole associated 1
Synonymssperiolin, 1700084J23Rik
MMRRC Submission 040685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3690 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76268089-76292572 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 76268295 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 42 (K42*)
Ref Sequence ENSEMBL: ENSMUSP00000155378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074173] [ENSMUST00000230221]
Predicted Effect probably null
Transcript: ENSMUST00000074173
AA Change: K42*
SMART Domains Protein: ENSMUSP00000073805
Gene: ENSMUSG00000049653
AA Change: K42*

DomainStartEndE-ValueType
Pfam:Speriolin_N 1 176 5.1e-67 PFAM
Pfam:Speriolin_N 172 262 1.2e-25 PFAM
Pfam:Speriolin_C 334 480 1.5e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175179
Predicted Effect probably null
Transcript: ENSMUST00000230221
AA Change: K42*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232408
Meta Mutation Damage Score 0.9650 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,091,329 Y629F probably benign Het
Abcb5 T A 12: 118,872,933 D1081V probably damaging Het
Afdn A G 17: 13,888,409 E1398G probably damaging Het
Atp8b5 T C 4: 43,368,055 C893R probably damaging Het
Avl9 C T 6: 56,736,827 H357Y probably benign Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Btbd19 A T 4: 117,120,592 probably benign Het
Cap1 A G 4: 122,864,626 S254P probably damaging Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cln6 T C 9: 62,846,970 I98T possibly damaging Het
Cul9 T C 17: 46,504,031 probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Ddias G A 7: 92,860,158 P183L probably benign Het
Dnase2b A T 3: 146,593,571 Y42* probably null Het
Dusp16 C T 6: 134,761,119 probably benign Het
Egfr T C 11: 16,871,881 probably benign Het
Fam171a1 T C 2: 3,226,356 V842A probably benign Het
Folr1 T C 7: 101,858,538 S232G probably benign Het
Foxj3 T C 4: 119,616,642 probably benign Het
Fpr-rs6 T C 17: 20,182,875 M75V probably benign Het
Fxyd5 G T 7: 31,036,439 L128M possibly damaging Het
Gigyf2 T C 1: 87,421,516 S500P possibly damaging Het
Inppl1 A G 7: 101,832,068 L268P probably damaging Het
Klk1b24 A T 7: 44,191,819 H192L probably benign Het
Llgl1 T G 11: 60,707,002 Y316D probably damaging Het
Lmbrd1 T A 1: 24,762,293 *143R probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mcm3ap A G 10: 76,482,679 E678G probably damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Nav1 T A 1: 135,467,644 I996L probably benign Het
Neb T C 2: 52,137,385 E6868G probably damaging Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nup50 C T 15: 84,939,793 T449M probably damaging Het
Olfr11 A G 13: 21,639,338 F62L probably damaging Het
Olfr294 G A 7: 86,616,478 P56S probably damaging Het
Olfr612 T C 7: 103,539,067 T56A probably benign Het
Olfr666 T C 7: 104,893,517 Y37C possibly damaging Het
Olfr675 A G 7: 105,024,695 L95P probably damaging Het
Pald1 A T 10: 61,355,808 probably null Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Ric3 A G 7: 109,038,610 V312A possibly damaging Het
Scaper C T 9: 55,883,921 G231D probably benign Het
Smc1b T A 15: 85,117,263 probably benign Het
Smcr8 A G 11: 60,778,028 M1V probably null Het
Smtn T C 11: 3,527,687 probably benign Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tex47 A G 5: 7,304,777 probably benign Het
Tram2 T A 1: 21,005,600 Y198F probably damaging Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Ube3a A G 7: 59,276,799 K442E probably damaging Het
Vmn2r116 T A 17: 23,384,824 F8I unknown Het
Vmn2r59 A G 7: 42,011,946 F815S possibly damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zfp579 T C 7: 4,994,720 H64R probably damaging Het
Other mutations in Spatc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Spatc1 APN 15 76284794 missense probably damaging 1.00
IGL02215:Spatc1 APN 15 76283539 splice site probably benign
IGL02678:Spatc1 APN 15 76292372 missense probably damaging 1.00
R0452:Spatc1 UTSW 15 76268293 missense probably damaging 1.00
R1972:Spatc1 UTSW 15 76284875 intron probably null
R2066:Spatc1 UTSW 15 76283537 splice site probably null
R2921:Spatc1 UTSW 15 76283925 missense probably damaging 1.00
R3689:Spatc1 UTSW 15 76268295 nonsense probably null
R4519:Spatc1 UTSW 15 76292485 missense probably damaging 1.00
R5944:Spatc1 UTSW 15 76283938 missense probably damaging 1.00
R7008:Spatc1 UTSW 15 76283723 missense probably benign 0.00
R7034:Spatc1 UTSW 15 76283880 missense probably benign 0.00
R7036:Spatc1 UTSW 15 76283880 missense probably benign 0.00
R7436:Spatc1 UTSW 15 76268368 missense probably benign 0.21
X0023:Spatc1 UTSW 15 76268372 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGACTCTGGTGGCCTTTTCC -3'
(R):5'- TGAGGCCAATGTCCTCTGTTTG -3'

Sequencing Primer
(F):5'- TTTTCCAGCCCGGGCAAG -3'
(R):5'- CAATTTCTTCAGACCCCAGCATC -3'
Posted On2015-02-19