Mutagenetix > Incidental Mutations

Incidental Mutation 'R3690:Cul9'

269752

Institutional Source

Beutler Lab

Gene Symbol

Cul9

Ensembl Gene

ENSMUSG00000040327

Gene Name

cullin 9

Synonyms

1810035I07Rik, Parc

MMRRC Submission

040685-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.260) question?

Stock #

R3690 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46500572-46546388 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 46504031 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000138418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046497] [ENSMUST00000066026] [ENSMUST00000066026] [ENSMUST00000182485] [ENSMUST00000182485]

Predicted Effect

probably benign
Transcript: ENSMUST00000046497

SMART Domains

Protein: ENSMUSP00000045283
Gene: ENSMUSG00000040658

Domain	Start	End	E-Value	Type
Pfam:Nuc_deoxyrib_tr	12	144	3.8e-21	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000066026

SMART Domains

Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	441	1e-35	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	2e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
low complexity region	2503	2520	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000066026

SMART Domains

Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	441	1e-35	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	2e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
low complexity region	2503	2520	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181301

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182315

Predicted Effect

probably null
Transcript: ENSMUST00000182485

SMART Domains

Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	442	1.4e-33	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	3e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
coiled coil region	2461	2497	N/A	INTRINSIC
low complexity region	2513	2530	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000182485

SMART Domains

Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	442	1.4e-33	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	3e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
coiled coil region	2461	2497	N/A	INTRINSIC
low complexity region	2513	2530	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182530

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183312

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	A	6: 23,091,329	Y629F	probably benign	Het
Abcb5	T	A	12: 118,872,933	D1081V	probably damaging	Het
Afdn	A	G	17: 13,888,409	E1398G	probably damaging	Het
Atp8b5	T	C	4: 43,368,055	C893R	probably damaging	Het
Avl9	C	T	6: 56,736,827	H357Y	probably benign	Het
Bclaf1	C	T	10: 20,325,397	T423I	possibly damaging	Het
Btbd19	A	T	4: 117,120,592		probably benign	Het
Cap1	A	G	4: 122,864,626	S254P	probably damaging	Het
Cdc42ep1	T	C	15: 78,847,429	S25P	probably benign	Het
Cln6	T	C	9: 62,846,970	I98T	possibly damaging	Het
Dcx	T	C	X: 143,877,244	E268G	possibly damaging	Het
Ddias	G	A	7: 92,860,158	P183L	probably benign	Het
Dnase2b	A	T	3: 146,593,571	Y42*	probably null	Het
Dusp16	C	T	6: 134,761,119		probably benign	Het
Egfr	T	C	11: 16,871,881		probably benign	Het
Fam171a1	T	C	2: 3,226,356	V842A	probably benign	Het
Folr1	T	C	7: 101,858,538	S232G	probably benign	Het
Foxj3	T	C	4: 119,616,642		probably benign	Het
Fpr-rs6	T	C	17: 20,182,875	M75V	probably benign	Het
Fxyd5	G	T	7: 31,036,439	L128M	possibly damaging	Het
Gigyf2	T	C	1: 87,421,516	S500P	possibly damaging	Het
Inppl1	A	G	7: 101,832,068	L268P	probably damaging	Het
Klk1b24	A	T	7: 44,191,819	H192L	probably benign	Het
Llgl1	T	G	11: 60,707,002	Y316D	probably damaging	Het
Lmbrd1	T	A	1: 24,762,293	*143R	probably null	Het
Map3k15	T	A	X: 160,122,572	N1295K	possibly damaging	Het
Mcm3ap	A	G	10: 76,482,679	E678G	probably damaging	Het
Mrpl44	T	A	1: 79,779,649	Y270*	probably null	Het
Nav1	T	A	1: 135,467,644	I996L	probably benign	Het
Neb	T	C	2: 52,137,385	E6868G	probably damaging	Het
Nexmif	A	T	X: 104,087,607	Y235N	probably damaging	Het
Nup50	C	T	15: 84,939,793	T449M	probably damaging	Het
Olfr11	A	G	13: 21,639,338	F62L	probably damaging	Het
Olfr294	G	A	7: 86,616,478	P56S	probably damaging	Het
Olfr612	T	C	7: 103,539,067	T56A	probably benign	Het
Olfr666	T	C	7: 104,893,517	Y37C	possibly damaging	Het
Olfr675	A	G	7: 105,024,695	L95P	probably damaging	Het
Pald1	A	T	10: 61,355,808		probably null	Het
Pde11a	T	A	2: 76,291,166	K357I	probably damaging	Het
Ric3	A	G	7: 109,038,610	V312A	possibly damaging	Het
Scaper	C	T	9: 55,883,921	G231D	probably benign	Het
Smc1b	T	A	15: 85,117,263		probably benign	Het
Smcr8	A	G	11: 60,778,028	M1V	probably null	Het
Smtn	T	C	11: 3,527,687		probably benign	Het
Spatc1	A	T	15: 76,268,295	K42*	probably null	Het
Taf7l	A	T	X: 134,464,325	I449K	probably damaging	Het
Tex47	A	G	5: 7,304,777		probably benign	Het
Tram2	T	A	1: 21,005,600	Y198F	probably damaging	Het
Ttn	C	G	2: 76,799,244	W14284C	probably damaging	Het
Ube3a	A	G	7: 59,276,799	K442E	probably damaging	Het
Vmn2r116	T	A	17: 23,384,824	F8I	unknown	Het
Vmn2r59	A	G	7: 42,011,946	F815S	possibly damaging	Het
Zap70	T	C	1: 36,781,412	C563R	probably damaging	Het
Zfp579	T	C	7: 4,994,720	H64R	probably damaging	Het

Other mutations in Cul9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Cul9	APN	17	46525709	missense	probably damaging	1.00
IGL00330:Cul9	APN	17	46510841	splice site	probably benign
IGL00726:Cul9	APN	17	46528096	missense	probably damaging	1.00
IGL01020:Cul9	APN	17	46539023	missense	probably damaging	1.00
IGL01358:Cul9	APN	17	46538314	missense	probably damaging	1.00
IGL01410:Cul9	APN	17	46528646	missense	probably damaging	0.99
IGL01781:Cul9	APN	17	46539304	missense	probably benign
IGL01873:Cul9	APN	17	46502452	missense	probably damaging	0.99
IGL02117:Cul9	APN	17	46540375	missense	probably benign	0.00
IGL02300:Cul9	APN	17	46521032	splice site	probably benign
IGL02426:Cul9	APN	17	46523258	missense	possibly damaging	0.95
IGL02427:Cul9	APN	17	46502632	missense	possibly damaging	0.69
IGL02496:Cul9	APN	17	46540376	missense	possibly damaging	0.72
IGL03008:Cul9	APN	17	46502697	splice site	probably benign
IGL03059:Cul9	APN	17	46538987	missense	probably damaging	0.98
IGL03302:Cul9	APN	17	46526640	missense	probably damaging	0.98
bottlenose	UTSW	17	46500844	missense	possibly damaging	0.79
flipper	UTSW	17	46525892	missense	probably benign	0.05
orca	UTSW	17	46525135	missense	probably damaging	1.00
FR4340:Cul9	UTSW	17	46500853	small insertion	probably benign
FR4449:Cul9	UTSW	17	46500856	small insertion	probably benign
FR4737:Cul9	UTSW	17	46500846	small insertion	probably benign
FR4737:Cul9	UTSW	17	46500858	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500848	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500850	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500853	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500856	small insertion	probably benign
R0012:Cul9	UTSW	17	46538510	missense	probably benign	0.26
R0079:Cul9	UTSW	17	46537663	nonsense	probably null
R0143:Cul9	UTSW	17	46526410	missense	possibly damaging	0.65
R0390:Cul9	UTSW	17	46528589	missense	probably benign	0.34
R0401:Cul9	UTSW	17	46541704	missense	probably damaging	1.00
R0529:Cul9	UTSW	17	46520468	splice site	probably benign
R0815:Cul9	UTSW	17	46537822	splice site	probably null
R0863:Cul9	UTSW	17	46537822	splice site	probably null
R0972:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1173:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1216:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1217:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1261:Cul9	UTSW	17	46525782	missense	probably damaging	1.00
R1278:Cul9	UTSW	17	46500849	small deletion	probably benign
R1281:Cul9	UTSW	17	46511534	missense	probably damaging	1.00
R1349:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1372:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1403:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1403:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1405:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1405:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1467:Cul9	UTSW	17	46525373	missense	probably damaging	1.00
R1467:Cul9	UTSW	17	46525373	missense	probably damaging	1.00
R1482:Cul9	UTSW	17	46508547	missense	probably damaging	0.99
R1491:Cul9	UTSW	17	46538564	nonsense	probably null
R1618:Cul9	UTSW	17	46525892	missense	probably benign	0.05
R1641:Cul9	UTSW	17	46543560	missense	possibly damaging	0.96
R1679:Cul9	UTSW	17	46521156	missense	possibly damaging	0.90
R1771:Cul9	UTSW	17	46537812	missense	probably benign	0.41
R1803:Cul9	UTSW	17	46503097	missense	probably damaging	1.00
R2020:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R2046:Cul9	UTSW	17	46543733	missense	probably damaging	1.00
R2056:Cul9	UTSW	17	46543372	missense	probably benign
R2088:Cul9	UTSW	17	46526649	missense	probably damaging	1.00
R2415:Cul9	UTSW	17	46543438	missense	probably benign
R2925:Cul9	UTSW	17	46510981	missense	probably benign	0.08
R2964:Cul9	UTSW	17	46502228	missense	probably damaging	0.96
R2965:Cul9	UTSW	17	46502228	missense	probably damaging	0.96
R3847:Cul9	UTSW	17	46525135	missense	probably damaging	1.00
R4437:Cul9	UTSW	17	46502159	missense	probably damaging	1.00
R4470:Cul9	UTSW	17	46538336	missense	probably benign	0.00
R4540:Cul9	UTSW	17	46503089	missense	probably null	0.98
R4555:Cul9	UTSW	17	46501829	missense	possibly damaging	0.82
R4604:Cul9	UTSW	17	46530146	missense	probably damaging	0.99
R4646:Cul9	UTSW	17	46539017	nonsense	probably null
R4799:Cul9	UTSW	17	46500844	missense	possibly damaging	0.79
R4822:Cul9	UTSW	17	46530051	missense	probably benign	0.01
R4964:Cul9	UTSW	17	46538525	missense	probably damaging	1.00
R4965:Cul9	UTSW	17	46538525	missense	probably damaging	1.00
R5027:Cul9	UTSW	17	46500782	missense	probably damaging	0.99
R5185:Cul9	UTSW	17	46525832	missense	possibly damaging	0.95
R5237:Cul9	UTSW	17	46543467	missense	probably benign	0.00
R5278:Cul9	UTSW	17	46510873	missense	probably damaging	1.00
R5361:Cul9	UTSW	17	46500849	small deletion	probably benign
R5455:Cul9	UTSW	17	46510846	splice site	probably null
R5592:Cul9	UTSW	17	46520591	missense	probably benign	0.00
R5597:Cul9	UTSW	17	46502665	missense	possibly damaging	0.56
R5613:Cul9	UTSW	17	46503844	missense	probably damaging	1.00
R6122:Cul9	UTSW	17	46521928	missense	possibly damaging	0.72
R6135:Cul9	UTSW	17	46521453	missense	probably benign
R6352:Cul9	UTSW	17	46511315	missense	probably benign	0.00
R6376:Cul9	UTSW	17	46508563	missense	probably damaging	1.00
R6868:Cul9	UTSW	17	46522183	missense	possibly damaging	0.73
R6898:Cul9	UTSW	17	46511026	missense	possibly damaging	0.87
R7090:Cul9	UTSW	17	46500839	missense	probably damaging	0.96
R7193:Cul9	UTSW	17	46538497	missense	probably damaging	0.98
R7221:Cul9	UTSW	17	46528565	missense	probably damaging	0.99
R7291:Cul9	UTSW	17	46540433	missense	probably benign	0.00
R7320:Cul9	UTSW	17	46510909	missense	possibly damaging	0.80
R7348:Cul9	UTSW	17	46510993	missense	possibly damaging	0.89
R7463:Cul9	UTSW	17	46520476	splice site	probably null
R7480:Cul9	UTSW	17	46537812	missense	probably benign	0.41
R7573:Cul9	UTSW	17	46519910	missense	probably benign
R7582:Cul9	UTSW	17	46510979	missense	probably damaging	1.00
R7605:Cul9	UTSW	17	46541732	missense	probably damaging	0.99
R7684:Cul9	UTSW	17	46509889	missense	probably damaging	1.00
R7830:Cul9	UTSW	17	46540311	missense	probably benign	0.37
R7834:Cul9	UTSW	17	46525704	splice site	probably null
R8131:Cul9	UTSW	17	46511242	missense	probably damaging	1.00
R8192:Cul9	UTSW	17	46538347	missense	probably benign	0.01
R8231:Cul9	UTSW	17	46520501	missense	probably damaging	0.99
R8248:Cul9	UTSW	17	46530014	missense	probably damaging	0.99
R8504:Cul9	UTSW	17	46503580	missense	probably damaging	1.00
R8550:Cul9	UTSW	17	46519846	missense	probably damaging	1.00
RF011:Cul9	UTSW	17	46500848	small insertion	probably benign
RF016:Cul9	UTSW	17	46500863	nonsense	probably null
RF026:Cul9	UTSW	17	46500869	nonsense	probably null
RF027:Cul9	UTSW	17	46500848	small insertion	probably benign
RF030:Cul9	UTSW	17	46500869	small insertion	probably benign
RF033:Cul9	UTSW	17	46500854	small insertion	probably benign
RF039:Cul9	UTSW	17	46500854	small insertion	probably benign
RF041:Cul9	UTSW	17	46500854	nonsense	probably null
RF042:Cul9	UTSW	17	46540615	frame shift	probably null
RF057:Cul9	UTSW	17	46500863	nonsense	probably null
Z1176:Cul9	UTSW	17	46520576	nonsense	probably null
Z1176:Cul9	UTSW	17	46520585	nonsense	probably null
Z1177:Cul9	UTSW	17	46537797	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CCTCGGGAAAACTACAGCTGAAG -3'
(R):5'- GCTGTCTGTCTCTGATCAGC -3'

Sequencing Primer
(F):5'- ACAGGATGCGGTCACAGC -3'
(R):5'- GATCAGCCCGCCTTTCG -3'

Posted On

2015-02-19