Incidental Mutation 'R1819:Ifnlr1'
List |< first << previous [record 41 of 90] next >> last >|
ID269764
Institutional Source Beutler Lab
Gene Symbol Ifnlr1
Ensembl Gene ENSMUSG00000062157
Gene Nameinterferon lambda receptor 1
SynonymsIFNLR1, Il28ra, CRF2-12
MMRRC Submission 039847-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1819 (G1)
Quality Score60
Status Validated
Chromosome4
Chromosomal Location135686287-135708181 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to T at 135686523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074408]
Predicted Effect probably benign
Transcript: ENSMUST00000074408
SMART Domains Protein: ENSMUSP00000074009
Gene: ENSMUSG00000062157

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
FN3 24 108 7.75e0 SMART
transmembrane domain 226 248 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 376 397 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and normal with respect to viral infection, however antiviral response evoked by TLRs are significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,981,056 probably null Het
Abhd17a T C 10: 80,586,636 T71A probably benign Het
Acad11 G A 9: 104,114,539 probably null Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afdn A G 17: 13,850,848 T783A probably damaging Het
Akap13 T A 7: 75,608,705 M359K probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atl1 T C 12: 69,963,300 S547P probably benign Het
Bace1 A T 9: 45,857,162 T252S possibly damaging Het
BC034090 A G 1: 155,225,829 S230P possibly damaging Het
Bnc2 A G 4: 84,291,874 F778L possibly damaging Het
Capn2 T A 1: 182,472,597 K609N probably benign Het
Capn8 T A 1: 182,598,826 I242N probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccdc180 A G 4: 45,926,195 E1135G possibly damaging Het
Ccdc181 C T 1: 164,282,478 Q385* probably null Het
Cdh10 G T 15: 18,991,965 G437* probably null Het
Ceacam1 T A 7: 25,463,860 Q316L possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cers4 T A 8: 4,521,232 M267K probably benign Het
Csmd3 T C 15: 47,753,735 D1930G possibly damaging Het
Cyp2j11 A T 4: 96,297,739 V403D probably damaging Het
Cyp4v3 G A 8: 45,315,636 R296C possibly damaging Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dus2 T A 8: 106,051,848 W377R probably damaging Het
E330034G19Rik A G 14: 24,298,013 D111G probably damaging Het
Erich4 C T 7: 25,615,290 R66Q possibly damaging Het
Fcgbp G T 7: 28,085,283 R256L probably benign Het
Fdxr A T 11: 115,276,104 F53Y probably damaging Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Foxo3 A T 10: 42,197,611 D84E probably benign Het
Gin1 A G 1: 97,785,226 probably null Het
Gli3 C T 13: 15,725,792 Q1255* probably null Het
Gm4847 T A 1: 166,638,219 H267L probably damaging Het
Gpr171 T C 3: 59,097,920 I145V probably benign Het
Gpr68 T A 12: 100,878,403 H294L possibly damaging Het
Gys2 T C 6: 142,461,186 E148G probably damaging Het
Heatr5b T C 17: 78,791,511 D1320G probably damaging Het
Ift88 G A 14: 57,455,519 E392K probably damaging Het
Igsf9b T A 9: 27,311,593 S97T probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kcnj11 C T 7: 46,099,156 G248S probably benign Het
Kif28 T C 1: 179,705,754 K541E possibly damaging Het
Lilrb4a A G 10: 51,496,028 Y205C probably damaging Het
Lima1 T A 15: 99,819,936 H63L probably benign Het
Lonrf3 A G X: 36,358,708 I687V probably damaging Het
Lrba A G 3: 86,542,634 T2099A possibly damaging Het
Morn5 C T 2: 36,052,975 T29M probably damaging Het
Neurl1b G A 17: 26,438,700 R22H probably benign Het
Nr2e3 T C 9: 59,943,437 I380V probably damaging Het
Oas1c G A 5: 120,808,735 A10V possibly damaging Het
Olfr395 T C 11: 73,906,679 E271G probably benign Het
Olfr671 C T 7: 104,975,398 V196I probably benign Het
P3h3 T C 6: 124,854,932 T297A probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Plec C T 15: 76,179,906 R2056Q probably damaging Het
Plxna2 T A 1: 194,790,186 N1079K probably benign Het
Prr12 G C 7: 45,048,697 probably benign Het
Psip1 A G 4: 83,458,163 S480P probably benign Het
Ptpre A G 7: 135,668,993 probably benign Het
Pvalb A C 15: 78,202,584 V44G probably damaging Het
Rab3c T G 13: 110,084,135 Q164P possibly damaging Het
Rubcn T C 16: 32,826,914 K703R possibly damaging Het
Setd7 T G 3: 51,542,639 H122P probably benign Het
Slc26a8 A T 17: 28,684,834 F19I probably benign Het
Slc6a14 A G X: 21,741,047 D625G probably benign Het
Snx6 C T 12: 54,783,474 V67I possibly damaging Het
Syngr3 A G 17: 24,687,722 F40L possibly damaging Het
Syt8 G A 7: 142,438,234 G21R possibly damaging Het
Tagln A G 9: 45,930,840 F152L probably benign Het
Tcf12 G A 9: 72,109,717 T36M probably damaging Het
Tdrd6 C T 17: 43,626,551 S1202N probably benign Het
Tekt2 T C 4: 126,323,736 K179E probably damaging Het
Tekt4 G T 17: 25,473,811 probably null Het
Tmprss5 G T 9: 49,107,164 R98L probably benign Het
Tns1 G T 1: 73,916,476 probably benign Het
Tpcn1 A C 5: 120,536,227 probably null Het
Ttc6 T C 12: 57,694,500 probably null Het
Ttf1 A G 2: 29,074,784 N706S possibly damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr17 A T 8: 54,690,124 S140T probably benign Het
Wdr19 A T 5: 65,212,891 I123F possibly damaging Het
Zer1 C T 2: 30,110,218 A317T probably benign Het
Zfp474 A G 18: 52,638,800 D175G probably damaging Het
Zfp598 T C 17: 24,681,130 probably benign Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Ifnlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Ifnlr1 APN 4 135704285 missense probably benign 0.28
IGL01637:Ifnlr1 APN 4 135686545 missense possibly damaging 0.63
IGL02090:Ifnlr1 APN 4 135705267 missense probably benign 0.23
R0677:Ifnlr1 UTSW 4 135705634 missense possibly damaging 0.78
R0723:Ifnlr1 UTSW 4 135701213 splice site probably benign
R0762:Ifnlr1 UTSW 4 135701329 missense possibly damaging 0.90
R1169:Ifnlr1 UTSW 4 135705108 missense probably benign 0.00
R1303:Ifnlr1 UTSW 4 135704217 missense possibly damaging 0.67
R1957:Ifnlr1 UTSW 4 135686570 missense probably damaging 1.00
R2041:Ifnlr1 UTSW 4 135705837 missense possibly damaging 0.51
R2509:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R2510:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R2511:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R3020:Ifnlr1 UTSW 4 135705730 small deletion probably benign
R3944:Ifnlr1 UTSW 4 135701228 missense probably damaging 1.00
R4495:Ifnlr1 UTSW 4 135705768 missense probably damaging 0.98
R4804:Ifnlr1 UTSW 4 135705336 missense possibly damaging 0.50
R4938:Ifnlr1 UTSW 4 135705282 missense probably benign 0.35
R5070:Ifnlr1 UTSW 4 135704198 missense probably benign 0.00
R5073:Ifnlr1 UTSW 4 135705146 missense probably benign 0.06
R5493:Ifnlr1 UTSW 4 135705566 missense probably benign 0.25
R5913:Ifnlr1 UTSW 4 135705269 missense probably damaging 1.00
R5913:Ifnlr1 UTSW 4 135705270 missense probably damaging 1.00
R5959:Ifnlr1 UTSW 4 135705341 missense possibly damaging 0.94
R6032:Ifnlr1 UTSW 4 135705626 missense probably benign 0.03
R6032:Ifnlr1 UTSW 4 135705626 missense probably benign 0.03
R6136:Ifnlr1 UTSW 4 135703797 missense possibly damaging 0.92
R7018:Ifnlr1 UTSW 4 135703824 missense possibly damaging 0.77
R7651:Ifnlr1 UTSW 4 135690608 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TCGAACTCTACCCTAGGTGC -3'
(R):5'- GCAAGTGTACAGAATCCCTGAG -3'

Sequencing Primer
(F):5'- AGGTGCTATTTACTCCTCAACGGAAC -3'
(R):5'- GTACAGAATCCCTGAGGCCCAG -3'
Posted On2015-02-27