Incidental Mutation 'R1900:Cntrob'
ID 269768
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
MMRRC Submission 039920-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R1900 (G1)
Quality Score 59
Status Validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69198880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 623 (S623T)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176] [ENSMUST00000130780]
AlphaFold Q8CB62
Predicted Effect probably benign
Transcript: ENSMUST00000092973
AA Change: S623T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: S623T

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect probably benign
Transcript: ENSMUST00000130780
SMART Domains Protein: ENSMUSP00000134842
Gene: ENSMUSG00000032782

DomainStartEndE-ValueType
low complexity region 50 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156175
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330409D20Rik T C 2: 32,630,559 (GRCm39) probably benign Het
Ago4 T C 4: 126,410,729 (GRCm39) I221V probably benign Het
Ankfy1 C T 11: 72,645,233 (GRCm39) Q771* probably null Het
Ankrd50 T C 3: 38,509,536 (GRCm39) T944A probably damaging Het
Armh4 T C 14: 50,008,040 (GRCm39) T478A probably damaging Het
AU040320 A C 4: 126,747,073 (GRCm39) probably null Het
Axdnd1 A G 1: 156,208,344 (GRCm39) probably null Het
Cdadc1 A T 14: 59,823,981 (GRCm39) D170E probably damaging Het
Cep164 C A 9: 45,721,123 (GRCm39) R93L probably damaging Het
Cep250 T C 2: 155,827,294 (GRCm39) probably null Het
Cfdp1 G A 8: 112,495,361 (GRCm39) R286* probably null Het
Chrdl2 A G 7: 99,682,871 (GRCm39) I377V possibly damaging Het
Col6a5 C T 9: 105,808,412 (GRCm39) G879S unknown Het
Cyp2c38 T A 19: 39,426,756 (GRCm39) I182F probably benign Het
Dennd4a T C 9: 64,804,618 (GRCm39) V1319A probably damaging Het
Dysf T G 6: 84,016,549 (GRCm39) V70G probably damaging Het
Edn3 A G 2: 174,603,398 (GRCm39) T49A possibly damaging Het
Elac1 C G 18: 73,872,316 (GRCm39) L226F probably damaging Het
Eps8l3 A G 3: 107,798,268 (GRCm39) D445G probably benign Het
Fgf11 G T 11: 69,692,279 (GRCm39) T58K probably benign Het
Fstl5 T A 3: 76,615,467 (GRCm39) W843R probably damaging Het
Fyb2 A G 4: 104,802,652 (GRCm39) R185G probably benign Het
Gal3st2c G A 1: 93,936,766 (GRCm39) R237H probably damaging Het
Galnt15 G T 14: 31,771,822 (GRCm39) R289L probably damaging Het
Garin4 T A 1: 190,896,631 (GRCm39) K4M possibly damaging Het
Gdf5 T A 2: 155,784,001 (GRCm39) D317V probably damaging Het
Gm7808 A G 9: 19,839,410 (GRCm39) probably benign Het
Hcn3 T C 3: 89,055,570 (GRCm39) E559G probably benign Het
Hdlbp A T 1: 93,349,959 (GRCm39) probably benign Het
Hhip T C 8: 80,701,675 (GRCm39) T620A probably benign Het
Hs3st3a1 T C 11: 64,411,268 (GRCm39) S269P probably damaging Het
Il17ra A T 6: 120,454,355 (GRCm39) probably null Het
Kif2a T C 13: 107,113,503 (GRCm39) N417S possibly damaging Het
Klhl41 T A 2: 69,504,963 (GRCm39) probably benign Het
L3mbtl4 G T 17: 68,766,800 (GRCm39) C169F probably damaging Het
Lap3 T C 5: 45,669,252 (GRCm39) F467S probably damaging Het
Lpar6 A T 14: 73,476,579 (GRCm39) Y180F probably benign Het
Lrig3 T C 10: 125,838,262 (GRCm39) probably benign Het
Ltbp2 A T 12: 84,877,432 (GRCm39) S378T probably damaging Het
Ltf T C 9: 110,851,913 (GRCm39) F117L possibly damaging Het
Med16 T C 10: 79,734,765 (GRCm39) E533G probably damaging Het
Meltf T C 16: 31,700,787 (GRCm39) probably null Het
Mphosph10 C T 7: 64,030,776 (GRCm39) E488K possibly damaging Het
Mroh1 A G 15: 76,317,585 (GRCm39) T812A probably benign Het
Mto1 T C 9: 78,368,799 (GRCm39) probably benign Het
Ndst1 A T 18: 60,845,793 (GRCm39) probably null Het
Ndst4 T A 3: 125,491,544 (GRCm39) probably null Het
Nhlh1 A T 1: 171,881,608 (GRCm39) I86N probably damaging Het
Nme9 A C 9: 99,341,827 (GRCm39) D59A probably damaging Het
Nox4 A T 7: 87,010,004 (GRCm39) R402* probably null Het
Npr1 T C 3: 90,369,495 (GRCm39) D410G probably damaging Het
Nrip1 T A 16: 76,088,927 (GRCm39) T877S probably benign Het
Nsd2 A G 5: 34,003,513 (GRCm39) N221S probably benign Het
Ophn1 A T X: 97,769,665 (GRCm39) Y181* probably null Het
Or13a28 A T 7: 140,218,505 (GRCm39) D297V probably damaging Het
Or1e17 C A 11: 73,831,486 (GRCm39) P138Q possibly damaging Het
Or4c123 T C 2: 89,127,014 (GRCm39) N200S probably damaging Het
Or51ac3 A T 7: 103,213,814 (GRCm39) L224* probably null Het
Or51f5 A T 7: 102,424,538 (GRCm39) H269L probably benign Het
Or5b109 T A 19: 13,212,277 (GRCm39) I221K possibly damaging Het
Or8c10 A T 9: 38,279,360 (GRCm39) I173L probably benign Het
Parp1 A G 1: 180,424,904 (GRCm39) K819R probably damaging Het
Parp9 T C 16: 35,792,591 (GRCm39) S829P probably benign Het
Pde6c T A 19: 38,150,388 (GRCm39) F511Y probably damaging Het
Per3 G T 4: 151,125,883 (GRCm39) H145Q probably damaging Het
Pglyrp1 C T 7: 18,624,151 (GRCm39) R145W probably damaging Het
Piezo1 T C 8: 123,209,384 (GRCm39) probably benign Het
Plb1 T C 5: 32,444,191 (GRCm39) I312T probably benign Het
Plin3 T A 17: 56,586,824 (GRCm39) T408S possibly damaging Het
Polr2a A T 11: 69,634,772 (GRCm39) I636N probably damaging Het
Pramel51 A C 12: 88,144,030 (GRCm39) L261R probably benign Het
Prb1b A T 6: 132,291,661 (GRCm39) L11Q unknown Het
Prex2 G T 1: 11,232,590 (GRCm39) E886* probably null Het
Proca1 A T 11: 78,095,847 (GRCm39) I73F probably damaging Het
Ptpn6 A G 6: 124,705,896 (GRCm39) S83P probably benign Het
Rtp1 G T 16: 23,248,049 (GRCm39) V41L probably benign Het
Scn4a A G 11: 106,218,359 (GRCm39) I1035T probably damaging Het
Sell A T 1: 163,892,907 (GRCm39) Y41F probably damaging Het
Serping1 C T 2: 84,601,793 (GRCm39) V226M probably damaging Het
Sf3b1 A T 1: 55,037,347 (GRCm39) D856E possibly damaging Het
Sfmbt1 T A 14: 30,524,524 (GRCm39) Y503N probably damaging Het
Slc16a1 T A 3: 104,560,880 (GRCm39) V395D probably damaging Het
Slc22a7 A T 17: 46,749,157 (GRCm39) D53E probably benign Het
Slc35b3 A G 13: 39,144,587 (GRCm39) probably null Het
Slc6a1 T C 6: 114,288,815 (GRCm39) M274T possibly damaging Het
Slco1a5 A G 6: 142,187,789 (GRCm39) S517P probably benign Het
Smo A G 6: 29,736,055 (GRCm39) R16G unknown Het
Srebf1 A G 11: 60,094,312 (GRCm39) L601P probably damaging Het
Sspo A G 6: 48,436,284 (GRCm39) I1086M probably benign Het
Tas2r106 A T 6: 131,655,373 (GRCm39) N159K probably damaging Het
Thsd1 G A 8: 22,742,334 (GRCm39) probably benign Het
Tmeff1 T C 4: 48,658,938 (GRCm39) probably benign Het
Tmem140 G A 6: 34,849,838 (GRCm39) C118Y possibly damaging Het
Tmem168 A G 6: 13,583,070 (GRCm39) C220R probably benign Het
Tox2 A T 2: 163,118,087 (GRCm39) N129Y probably damaging Het
Trappc12 C T 12: 28,796,984 (GRCm39) E183K probably damaging Het
Unc50 A G 1: 37,477,880 (GRCm39) Y254C probably damaging Het
Unk T G 11: 115,949,907 (GRCm39) D691E probably benign Het
Uox T A 3: 146,316,134 (GRCm39) V23D probably damaging Het
Vps13d A G 4: 144,853,176 (GRCm39) C2313R probably benign Het
Zfp804b T A 5: 6,819,283 (GRCm39) H1260L probably damaging Het
Zfyve26 A G 12: 79,311,125 (GRCm39) L147P probably damaging Het
Zmynd10 A T 9: 107,427,236 (GRCm39) Q288L probably benign Het
Zzef1 T A 11: 72,739,540 (GRCm39) D662E probably damaging Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGTAAGGCACCTAGAAACCAAAC -3'
(R):5'- CAGGCTGTGAGCTTGCTTTC -3'

Sequencing Primer
(F):5'- CGCTCCTATCAGAGAGAACTTGG -3'
(R):5'- GGCTGTGAGCTTGCTTTCTTTCTC -3'
Posted On 2015-02-27