Incidental Mutation 'R2041:Gpr153'
ID 269771
Institutional Source Beutler Lab
Gene Symbol Gpr153
Ensembl Gene ENSMUSG00000042804
Gene Name G protein-coupled receptor 153
Synonyms 1110065N12Rik, PGR1
MMRRC Submission 040048-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2041 (G1)
Quality Score 30
Status Validated
Chromosome 4
Chromosomal Location 152274232-152285337 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152283353 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 554 (S554G)
Ref Sequence ENSEMBL: ENSMUSP00000101276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055754] [ENSMUST00000094438] [ENSMUST00000105650] [ENSMUST00000105651] [ENSMUST00000218045]
AlphaFold Q8K0Z9
Predicted Effect probably benign
Transcript: ENSMUST00000055754
AA Change: S554G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052742
Gene: ENSMUSG00000042804
AA Change: S554G

DomainStartEndE-ValueType
Pfam:7tm_1 24 298 1.2e-14 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094438
SMART Domains Protein: ENSMUSP00000092006
Gene: ENSMUSG00000028946

DomainStartEndE-ValueType
HLH 1 55 3.83e-11 SMART
low complexity region 129 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105650
AA Change: S531G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101275
Gene: ENSMUSG00000042804
AA Change: S531G

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.4e-18 PFAM
low complexity region 478 495 N/A INTRINSIC
low complexity region 582 594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105651
AA Change: S554G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101276
Gene: ENSMUSG00000042804
AA Change: S554G

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.3e-17 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144035
Predicted Effect probably benign
Transcript: ENSMUST00000218045
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that belongs to the Class A rhodopsin superfamily of G protein coupled receptors. The encoded protein is expressed primarily in the central nervous system. A knockdown of the orthologous gene in rat is associated with a significant reduction in food intake and impaired decision making ability. Mutations in this gene are associated with schizophrenia, autism, and other neuropsychiatric disorders. The expression of this gene is activated by the glioma-associated oncogene homolog 1 transcription factor which, in turn, is activated by sonic hedgehog in normal and tumorigenic cells. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,401 D265E probably damaging Het
2610021A01Rik A G 7: 41,625,979 R369G possibly damaging Het
Actr3b T C 5: 25,760,130 probably null Het
Adamts12 A T 15: 11,215,735 M281L probably damaging Het
Aipl1 T A 11: 72,031,506 M126L possibly damaging Het
Akap12 C T 10: 4,356,489 P1100S probably benign Het
Alox8 T A 11: 69,197,691 H40L possibly damaging Het
Anks1 T A 17: 28,008,414 F659L probably damaging Het
Asxl3 G T 18: 22,523,451 R1506L probably benign Het
Bicd2 A G 13: 49,341,776 T36A probably benign Het
Ccar1 A T 10: 62,766,048 L448Q probably damaging Het
Ccdc17 T G 4: 116,599,592 N497K probably damaging Het
Chek2 T C 5: 110,848,664 I164T probably damaging Het
Cntnap5c T C 17: 58,104,770 probably null Het
Cntnap5c T A 17: 58,198,989 D669E probably benign Het
Cpsf6 A G 10: 117,359,128 I482T probably damaging Het
Csf3 C T 11: 98,701,657 S65L possibly damaging Het
Dlc1 A G 8: 36,582,768 Y1049H probably damaging Het
Dnah6 T C 6: 73,073,439 D3048G probably damaging Het
Eif4g3 T A 4: 138,105,306 probably benign Het
Epb41l4b T C 4: 57,084,070 K195R probably damaging Het
Epn1 T C 7: 5,083,875 S41P probably damaging Het
Fam120a C A 13: 48,897,767 V721L probably benign Het
Fchsd1 T A 18: 37,967,676 probably null Het
Fer1l6 G A 15: 58,558,306 G194D probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fyb A C 15: 6,644,787 T635P possibly damaging Het
Grm1 A G 10: 10,746,603 F459L probably damaging Het
H60c C T 10: 3,259,972 G105D probably damaging Het
Ifnlr1 T A 4: 135,705,837 M528K possibly damaging Het
Lama4 A T 10: 39,069,991 D790V probably damaging Het
Mfsd13b T C 7: 120,991,916 probably benign Het
Mis12 T A 11: 71,025,306 I55N probably damaging Het
Morn1 T C 4: 155,090,942 Y103H probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Ndst3 C A 3: 123,672,215 G36V probably benign Het
Nlrp4a T A 7: 26,450,186 M406K probably damaging Het
Olfr1154 T C 2: 87,902,797 N293S probably damaging Het
Olfr1179 T C 2: 88,402,224 T237A probably damaging Het
Olfr1459 A T 19: 13,146,677 probably benign Het
Olfr574 T A 7: 102,948,963 V156E probably damaging Het
Olfr851 A T 9: 19,496,835 D29V probably benign Het
Pars2 A G 4: 106,653,617 T199A probably damaging Het
Plcb4 C T 2: 135,938,271 T172I probably damaging Het
Pomgnt2 A T 9: 121,982,288 W476R probably benign Het
Psg23 T A 7: 18,614,778 S35C possibly damaging Het
Pycrl T A 15: 75,919,295 probably null Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rgs2 A G 1: 144,002,222 F80S probably damaging Het
Sall1 A G 8: 89,032,801 L225P probably benign Het
Setd3 A G 12: 108,113,392 I284T possibly damaging Het
Slc4a9 C T 18: 36,530,793 T290I possibly damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Ube3b T C 5: 114,387,233 L39P probably damaging Het
Ubr2 C A 17: 46,986,047 R269L probably damaging Het
Vrk2 A T 11: 26,547,914 I90K probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp984 A T 4: 147,755,339 C352S probably damaging Het
Other mutations in Gpr153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Gpr153 APN 4 152281966 unclassified probably benign
IGL01368:Gpr153 APN 4 152282994 missense probably benign 0.40
IGL01568:Gpr153 APN 4 152282368 splice site probably null
IGL01672:Gpr153 APN 4 152279913 nonsense probably null
R0735:Gpr153 UTSW 4 152279373 nonsense probably null
R0925:Gpr153 UTSW 4 152281874 missense probably benign
R1302:Gpr153 UTSW 4 152279943 missense probably damaging 1.00
R1829:Gpr153 UTSW 4 152282392 missense possibly damaging 0.70
R4698:Gpr153 UTSW 4 152281783 missense probably damaging 1.00
R5069:Gpr153 UTSW 4 152279883 missense probably damaging 0.99
R5623:Gpr153 UTSW 4 152281941 missense possibly damaging 0.89
R5800:Gpr153 UTSW 4 152280077 nonsense probably null
R5940:Gpr153 UTSW 4 152283375 missense probably benign 0.12
R6773:Gpr153 UTSW 4 152279300 missense probably damaging 1.00
R6944:Gpr153 UTSW 4 152279363 missense probably damaging 1.00
R7486:Gpr153 UTSW 4 152282401 missense probably benign 0.01
R8170:Gpr153 UTSW 4 152280177 missense probably damaging 1.00
R8699:Gpr153 UTSW 4 152279101 start gained probably benign
R8701:Gpr153 UTSW 4 152279101 start gained probably benign
R8732:Gpr153 UTSW 4 152279101 start gained probably benign
R9047:Gpr153 UTSW 4 152280207 missense probably damaging 1.00
R9383:Gpr153 UTSW 4 152283059 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCTCTGGCACACTTAATGC -3'
(R):5'- CTCAGAAAGCTGCTAATGCTG -3'

Sequencing Primer
(F):5'- GCACACTTAATGCTGCCCG -3'
(R):5'- AAGATGCGCTCAGGCTG -3'
Posted On 2015-02-27