Incidental Mutation 'R1882:Chia1'
ID269785
Institutional Source Beutler Lab
Gene Symbol Chia1
Ensembl Gene ENSMUSG00000062778
Gene Namechitinase, acidic 1
Synonyms2200003E03Rik, YNL, AMCase, Chia
MMRRC Submission 039903-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R1882 (G1)
Quality Score76
Status Validated
Chromosome3
Chromosomal Location106113229-106132120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106128474 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 150 (M150T)
Ref Sequence ENSEMBL: ENSMUSP00000121967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079132] [ENSMUST00000139086]
Predicted Effect probably damaging
Transcript: ENSMUST00000079132
AA Change: M210T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078134
Gene: ENSMUSG00000062778
AA Change: M210T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.82e-161 SMART
ChtBD2 425 473 2.06e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139086
AA Change: M150T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121967
Gene: ENSMUSG00000062778
AA Change: M150T

DomainStartEndE-ValueType
Glyco_18 3 215 2.24e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143128
Meta Mutation Damage Score 0.8770 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene degrades chitin, which is found in the cell wall of most fungi as well as in arthropods and some nematodes. The encoded protein can also stimulate interleukin 13 expression, and variations in this gene can lead to asthma susceptibility. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,798,506 S189P probably benign Het
Adgrg3 G T 8: 95,040,315 V433F probably benign Het
Arhgap33 A T 7: 30,522,809 W1233R probably damaging Het
Brf2 T C 8: 27,128,549 D9G probably damaging Het
Btrc G A 19: 45,527,400 R562Q probably damaging Het
Cenpu T C 8: 46,556,190 F67L probably damaging Het
Cntln A G 4: 85,100,835 E1254G probably damaging Het
Creld1 G A 6: 113,492,205 C332Y probably damaging Het
Ctla2a A G 13: 60,935,541 probably benign Het
Dusp13 A T 14: 21,734,975 D223E probably benign Het
Ext1 C A 15: 53,075,792 L620F probably damaging Het
Gm6614 C A 6: 141,993,637 probably null Het
H2-DMb2 C T 17: 34,147,860 R89C probably damaging Het
Klhl32 A T 4: 24,743,916 L17* probably null Het
Lats2 C T 14: 57,697,354 V640M probably damaging Het
Lrig3 G A 10: 126,009,825 V708I possibly damaging Het
Mtcl1 T C 17: 66,379,320 T415A probably benign Het
Mynn A G 3: 30,616,813 *611W probably null Het
Nfx1 A G 4: 41,009,240 T793A possibly damaging Het
Nlrp4d T C 7: 10,382,677 noncoding transcript Het
Nos3 T C 5: 24,368,820 V194A probably damaging Het
Npc1l1 C T 11: 6,217,473 probably null Het
Nrg2 T C 18: 36,021,097 D589G probably damaging Het
Olfr1008 T A 2: 85,689,606 M59K probably damaging Het
Olfr126 T C 17: 37,850,948 S119P probably damaging Het
Olfr1390 A G 11: 49,340,712 Y60C probably damaging Het
Olfr1418 T C 19: 11,855,471 T161A probably damaging Het
Omg C T 11: 79,501,719 probably benign Het
P2ry2 G T 7: 100,998,851 Y82* probably null Het
Pcdh1 T C 18: 38,202,842 T247A possibly damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pgm3 A G 9: 86,565,690 Y167H possibly damaging Het
Pramef20 A T 4: 144,376,915 C214S probably benign Het
Prmt2 T C 10: 76,222,468 H169R probably benign Het
Rad51ap2 T A 12: 11,456,250 S58T possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Slc6a15 T C 10: 103,395,064 S217P probably benign Het
Snx27 G A 3: 94,519,109 T361I probably damaging Het
St7l A G 3: 104,868,047 T80A probably damaging Het
Stk32b T A 5: 37,531,687 M98L possibly damaging Het
Tonsl C A 15: 76,624,150 A6S possibly damaging Het
Tpx2 A G 2: 152,869,691 R49G probably benign Het
Trmt2a A G 16: 18,249,894 K144E possibly damaging Het
Trpm7 A C 2: 126,812,777 L1414V probably benign Het
Ugdh T C 5: 65,423,596 K107E possibly damaging Het
Vamp3 A T 4: 151,050,909 probably benign Het
Vmn1r172 T C 7: 23,660,226 S179P probably damaging Het
Vmn1r28 A G 6: 58,265,978 M269V probably benign Het
Vmn2r94 T C 17: 18,244,214 T605A probably benign Het
Vwce A G 19: 10,638,156 T134A possibly damaging Het
Zfp277 T C 12: 40,445,746 E5G probably benign Het
Other mutations in Chia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01917:Chia1 APN 3 106128220 missense probably damaging 1.00
Pet UTSW 3 106129022 critical splice donor site probably null
R0004:Chia1 UTSW 3 106129009 missense probably damaging 1.00
R0011:Chia1 UTSW 3 106130974 unclassified probably benign
R0047:Chia1 UTSW 3 106115257 missense probably damaging 0.99
R0345:Chia1 UTSW 3 106122439 missense probably damaging 1.00
R0456:Chia1 UTSW 3 106128479 missense probably damaging 1.00
R0638:Chia1 UTSW 3 106128437 splice site probably benign
R0847:Chia1 UTSW 3 106131937 missense probably benign 0.12
R1055:Chia1 UTSW 3 106130883 missense probably damaging 1.00
R1401:Chia1 UTSW 3 106128939 missense probably benign 0.00
R1513:Chia1 UTSW 3 106131904 missense probably benign 0.44
R1846:Chia1 UTSW 3 106130865 missense probably damaging 0.98
R1914:Chia1 UTSW 3 106128559 missense probably benign 0.06
R1915:Chia1 UTSW 3 106128559 missense probably benign 0.06
R2107:Chia1 UTSW 3 106128840 nonsense probably null
R3969:Chia1 UTSW 3 106121635 splice site probably null
R3970:Chia1 UTSW 3 106121635 splice site probably null
R4112:Chia1 UTSW 3 106128528 missense probably damaging 1.00
R4432:Chia1 UTSW 3 106115325 missense probably benign 0.03
R4625:Chia1 UTSW 3 106128940 missense probably benign 0.00
R4748:Chia1 UTSW 3 106122449 missense probably damaging 1.00
R5805:Chia1 UTSW 3 106128476 missense probably damaging 0.98
R5906:Chia1 UTSW 3 106131988 missense probably benign 0.01
R6173:Chia1 UTSW 3 106129022 critical splice donor site probably null
R6214:Chia1 UTSW 3 106122445 missense probably damaging 1.00
R6215:Chia1 UTSW 3 106122445 missense probably damaging 1.00
R6225:Chia1 UTSW 3 106130897 missense possibly damaging 0.66
R6383:Chia1 UTSW 3 106131811 missense probably benign
R6423:Chia1 UTSW 3 106128988 missense possibly damaging 0.60
R6668:Chia1 UTSW 3 106130948 missense probably damaging 1.00
R6764:Chia1 UTSW 3 106130740 critical splice donor site probably null
R7030:Chia1 UTSW 3 106115325 missense probably damaging 1.00
R7221:Chia1 UTSW 3 106131920 missense probably damaging 1.00
R7265:Chia1 UTSW 3 106128923 missense probably damaging 1.00
R7343:Chia1 UTSW 3 106132015 makesense probably null
R7420:Chia1 UTSW 3 106130664 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGAGAACCTTTCAAGCATTGTAC -3'
(R):5'- TGGGGTGAAATTATAGACATGGCC -3'

Sequencing Primer
(F):5'- GTACATATTCTTCAGATGTCTTGTGC -3'
(R):5'- TCTGAACTAACATTAATCTGGAGCC -3'
Posted On2015-03-13