Incidental Mutation 'R3696:Anapc4'
ID269815
Institutional Source Beutler Lab
Gene Symbol Anapc4
Ensembl Gene ENSMUSG00000029176
Gene Nameanaphase promoting complex subunit 4
Synonyms2610306D21Rik, D5Ertd249e, APC4
MMRRC Submission 040690-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3696 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location52834012-52867797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52862009 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 562 (S562G)
Ref Sequence ENSEMBL: ENSMUSP00000031072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]
Predicted Effect probably null
Transcript: ENSMUST00000031072
AA Change: S562G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: S562G

DomainStartEndE-ValueType
Pfam:ANAPC4_WD40 10 57 9.1e-18 PFAM
low complexity region 137 147 N/A INTRINSIC
Pfam:ANAPC4 232 431 3.7e-61 PFAM
low complexity region 747 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142035
Predicted Effect probably benign
Transcript: ENSMUST00000144574
SMART Domains Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

DomainStartEndE-ValueType
Pfam:Apc4_WD40 10 57 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154980
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Arfgef2 T A 2: 166,853,300 L531* probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cacna1s A G 1: 136,105,814 M1010V probably damaging Het
Chga A G 12: 102,561,465 E126G probably damaging Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Dlat C T 9: 50,650,876 V283I possibly damaging Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Ephx1 G A 1: 180,989,951 S385L probably benign Het
Ermard T C 17: 15,053,376 S408P probably benign Het
Etl4 G A 2: 20,801,662 probably null Het
Hydin T C 8: 110,603,279 S4882P probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Itgb8 A G 12: 119,177,011 V377A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lama3 A G 18: 12,439,475 probably benign Het
Macf1 T G 4: 123,456,362 T2027P probably damaging Het
Myh13 A C 11: 67,345,044 I678L possibly damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Prm3 T C 16: 10,790,808 M28V possibly damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A T 11: 87,585,234 T212S possibly damaging Het
Trdn T A 10: 33,305,032 probably null Het
Trim2 T A 3: 84,190,851 Y390F probably benign Het
Vmn1r17 T A 6: 57,360,538 I232F possibly damaging Het
Zfp30 A T 7: 29,793,390 K356N probably damaging Het
Other mutations in Anapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Anapc4 APN 5 52857211 missense probably damaging 0.98
IGL01066:Anapc4 APN 5 52857209 missense probably benign 0.08
IGL01109:Anapc4 APN 5 52848628 missense probably damaging 1.00
IGL01657:Anapc4 APN 5 52864626 nonsense probably null
IGL02692:Anapc4 APN 5 52864529 missense probably damaging 0.98
IGL02734:Anapc4 APN 5 52861291 missense probably benign 0.04
IGL03089:Anapc4 APN 5 52866398 missense probably benign 0.32
IGL03096:Anapc4 APN 5 52865929 missense possibly damaging 0.57
FR4304:Anapc4 UTSW 5 52864526 missense probably damaging 1.00
IGL03048:Anapc4 UTSW 5 52839733 missense probably benign 0.00
R0331:Anapc4 UTSW 5 52855642 splice site probably benign
R0511:Anapc4 UTSW 5 52842017 unclassified probably benign
R0624:Anapc4 UTSW 5 52845419 splice site probably benign
R0919:Anapc4 UTSW 5 52855637 missense probably benign 0.18
R1935:Anapc4 UTSW 5 52839668 missense probably damaging 0.99
R1936:Anapc4 UTSW 5 52839668 missense probably damaging 0.99
R1942:Anapc4 UTSW 5 52846714 missense probably benign 0.30
R1953:Anapc4 UTSW 5 52839688 missense probably damaging 1.00
R1954:Anapc4 UTSW 5 52846625 intron probably benign
R2341:Anapc4 UTSW 5 52841937 unclassified probably benign
R4506:Anapc4 UTSW 5 52835730 missense possibly damaging 0.79
R4596:Anapc4 UTSW 5 52841718 missense probably benign 0.00
R5234:Anapc4 UTSW 5 52848776 missense probably damaging 1.00
R5256:Anapc4 UTSW 5 52863594 missense probably benign
R5310:Anapc4 UTSW 5 52859159 missense probably benign 0.00
R5401:Anapc4 UTSW 5 52863649 missense probably benign 0.01
R5409:Anapc4 UTSW 5 52848599 missense probably damaging 0.98
R5525:Anapc4 UTSW 5 52856809 missense probably damaging 1.00
R5575:Anapc4 UTSW 5 52855871 missense probably damaging 1.00
R5604:Anapc4 UTSW 5 52841734 nonsense probably null
R5695:Anapc4 UTSW 5 52862239 missense probably benign 0.00
R5955:Anapc4 UTSW 5 52865946 missense probably benign 0.01
R5974:Anapc4 UTSW 5 52845400 missense probably damaging 1.00
R6458:Anapc4 UTSW 5 52864553 missense possibly damaging 0.80
R6537:Anapc4 UTSW 5 52843556 missense probably damaging 0.98
R6633:Anapc4 UTSW 5 52865946 missense possibly damaging 0.85
R6860:Anapc4 UTSW 5 52848828 missense probably damaging 1.00
R6965:Anapc4 UTSW 5 52835751 missense possibly damaging 0.89
R7067:Anapc4 UTSW 5 52862235 missense probably benign
R7327:Anapc4 UTSW 5 52845330 missense probably damaging 0.99
R7442:Anapc4 UTSW 5 52857201 missense probably benign 0.08
R7837:Anapc4 UTSW 5 52859208 critical splice donor site probably null
R7920:Anapc4 UTSW 5 52859208 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGTGTGATCAGGGTCAAAC -3'
(R):5'- ATCAGTATGTCTCCTTAAGATGCAC -3'

Sequencing Primer
(F):5'- GGTCAAACCCAGCATTTTGC -3'
(R):5'- TATGAAGCTGCCTAGGGTAAACAC -3'
Posted On2015-03-18