Incidental Mutation 'R3696:Trdn'
ID269825
Institutional Source Beutler Lab
Gene Symbol Trdn
Ensembl Gene ENSMUSG00000019787
Gene Nametriadin
Synonymstriadin-2, triadin 2, triadin 1, triadin 3, EG432451, 2310045H21Rik, triadin-1, triadin-3
MMRRC Submission 040690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3696 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location33080554-33476709 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 33305032 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000095762]
Predicted Effect probably null
Transcript: ENSMUST00000095762
SMART Domains Protein: ENSMUSP00000093436
Gene: ENSMUSG00000019787

DomainStartEndE-ValueType
SCOP:d1lnqa2 49 116 1e-4 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 166 182 N/A INTRINSIC
low complexity region 198 223 N/A INTRINSIC
low complexity region 229 250 N/A INTRINSIC
coiled coil region 306 333 N/A INTRINSIC
low complexity region 342 352 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
coiled coil region 417 437 N/A INTRINSIC
low complexity region 448 484 N/A INTRINSIC
low complexity region 539 551 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219978
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a loss of transverse orientation of triads within skeletal muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Anapc4 A G 5: 52,862,009 S562G probably null Het
Arfgef2 T A 2: 166,853,300 L531* probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cacna1s A G 1: 136,105,814 M1010V probably damaging Het
Chga A G 12: 102,561,465 E126G probably damaging Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Dlat C T 9: 50,650,876 V283I possibly damaging Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Ephx1 G A 1: 180,989,951 S385L probably benign Het
Ermard T C 17: 15,053,376 S408P probably benign Het
Etl4 G A 2: 20,801,662 probably null Het
Hydin T C 8: 110,603,279 S4882P probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Itgb8 A G 12: 119,177,011 V377A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lama3 A G 18: 12,439,475 probably benign Het
Macf1 T G 4: 123,456,362 T2027P probably damaging Het
Myh13 A C 11: 67,345,044 I678L possibly damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Prm3 T C 16: 10,790,808 M28V possibly damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A T 11: 87,585,234 T212S possibly damaging Het
Trim2 T A 3: 84,190,851 Y390F probably benign Het
Vmn1r17 T A 6: 57,360,538 I232F possibly damaging Het
Zfp30 A T 7: 29,793,390 K356N probably damaging Het
Other mutations in Trdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Trdn APN 10 33471606 critical splice donor site probably null
IGL01310:Trdn APN 10 33305098 splice site probably benign
IGL01313:Trdn APN 10 33200220 missense probably damaging 1.00
IGL02177:Trdn APN 10 33139173 missense probably damaging 1.00
IGL02631:Trdn APN 10 33363976 critical splice acceptor site probably null
IGL02732:Trdn APN 10 33468199 splice site probably null
IGL03131:Trdn APN 10 33398414 nonsense probably null
Button UTSW 10 33474453 missense probably damaging 0.97
R0463:Trdn UTSW 10 33466421 critical splice acceptor site probably null
R0610:Trdn UTSW 10 33474453 missense probably damaging 0.97
R0786:Trdn UTSW 10 33305081 missense probably benign 0.22
R0827:Trdn UTSW 10 33399158 splice site probably benign
R1511:Trdn UTSW 10 33466452 missense probably benign 0.18
R1623:Trdn UTSW 10 33258102 missense possibly damaging 0.82
R1760:Trdn UTSW 10 33233887 missense possibly damaging 0.92
R1766:Trdn UTSW 10 33364008 missense probably damaging 1.00
R1884:Trdn UTSW 10 33257095 missense probably benign 0.38
R2297:Trdn UTSW 10 33335012 missense probably damaging 1.00
R2396:Trdn UTSW 10 33195982 missense probably damaging 1.00
R3436:Trdn UTSW 10 33468195 critical splice donor site probably null
R3686:Trdn UTSW 10 33468189 missense probably benign 0.20
R3701:Trdn UTSW 10 33334984 missense probably damaging 0.99
R3712:Trdn UTSW 10 33157166 missense probably benign 0.03
R4062:Trdn UTSW 10 33257087 missense probably benign 0.05
R4249:Trdn UTSW 10 33450998 missense probably benign 0.09
R4289:Trdn UTSW 10 33464582 missense probably benign 0.00
R4646:Trdn UTSW 10 33195981 nonsense probably null
R4647:Trdn UTSW 10 33195981 nonsense probably null
R4648:Trdn UTSW 10 33195981 nonsense probably null
R4766:Trdn UTSW 10 33474506 missense probably benign 0.04
R4776:Trdn UTSW 10 33399082 splice site probably null
R4880:Trdn UTSW 10 33471579 missense probably benign 0.26
R4898:Trdn UTSW 10 33474417 missense probably damaging 0.96
R5017:Trdn UTSW 10 33468159 missense probably benign 0.05
R5300:Trdn UTSW 10 33195982 missense probably damaging 1.00
R5320:Trdn UTSW 10 33333251 critical splice donor site probably null
R6089:Trdn UTSW 10 33464575 missense probably benign 0.01
R6216:Trdn UTSW 10 33305069 missense probably damaging 1.00
R6431:Trdn UTSW 10 33139114 missense probably damaging 1.00
R6475:Trdn UTSW 10 33464555 splice site probably null
R6501:Trdn UTSW 10 33466454 missense probably benign 0.02
R6662:Trdn UTSW 10 33474487 missense probably damaging 0.98
R6709:Trdn UTSW 10 33464591 missense probably benign 0.00
R6783:Trdn UTSW 10 33438815 missense probably damaging 0.96
R6906:Trdn UTSW 10 33233948 missense probably benign
R6916:Trdn UTSW 10 33157018 missense probably damaging 1.00
R7291:Trdn UTSW 10 33437736 missense probably null 0.83
R7499:Trdn UTSW 10 33196101 missense probably benign
R7601:Trdn UTSW 10 33196156 missense probably benign 0.00
R7743:Trdn UTSW 10 33257062 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCCATGGATGTTGAGAGG -3'
(R):5'- TTACTGAAGAAGAGTGGCCAGC -3'

Sequencing Primer
(F):5'- CCATGGATGTTGAGAGGGTATTG -3'
(R):5'- CAGATGGTGCCCTTCTGCAATAAAC -3'
Posted On2015-03-18