Incidental Mutation 'R3696:Ermard'
ID269838
Institutional Source Beutler Lab
Gene Symbol Ermard
Ensembl Gene ENSMUSG00000036552
Gene NameER membrane associated RNA degradation
Synonyms2410011O22Rik, 2210404J11Rik
MMRRC Submission 040690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R3696 (G1)
Quality Score166
Status Validated
Chromosome17
Chromosomal Location15041208-15090044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15053376 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 408 (S408P)
Ref Sequence ENSEMBL: ENSMUSP00000095005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040594] [ENSMUST00000097393] [ENSMUST00000227252] [ENSMUST00000228803]
Predicted Effect probably benign
Transcript: ENSMUST00000040594
SMART Domains Protein: ENSMUSP00000043677
Gene: ENSMUSG00000036552

DomainStartEndE-ValueType
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097393
AA Change: S408P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000095005
Gene: ENSMUSG00000036552
AA Change: S408P

DomainStartEndE-ValueType
Pfam:DUF4209 133 214 3.1e-27 PFAM
low complexity region 390 399 N/A INTRINSIC
SCOP:g1pnb.1 429 478 4e-3 SMART
low complexity region 583 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227177
Predicted Effect probably benign
Transcript: ENSMUST00000227252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227786
Predicted Effect probably benign
Transcript: ENSMUST00000228803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231568
Meta Mutation Damage Score 0.2008 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains 2 transmembrane domains near the C-terminus and is localized in the endoplasmic reticulum. Knockout of this gene in developing rat brain showed that it may be involved in neuronal migration. Mutations in this gene are associated with periventricular nodular heterotopia-6 (PVNH6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Anapc4 A G 5: 52,862,009 S562G probably null Het
Arfgef2 T A 2: 166,853,300 L531* probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cacna1s A G 1: 136,105,814 M1010V probably damaging Het
Chga A G 12: 102,561,465 E126G probably damaging Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Dlat C T 9: 50,650,876 V283I possibly damaging Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Ephx1 G A 1: 180,989,951 S385L probably benign Het
Etl4 G A 2: 20,801,662 probably null Het
Hydin T C 8: 110,603,279 S4882P probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Itgb8 A G 12: 119,177,011 V377A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lama3 A G 18: 12,439,475 probably benign Het
Macf1 T G 4: 123,456,362 T2027P probably damaging Het
Myh13 A C 11: 67,345,044 I678L possibly damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Prm3 T C 16: 10,790,808 M28V possibly damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A T 11: 87,585,234 T212S possibly damaging Het
Trdn T A 10: 33,305,032 probably null Het
Trim2 T A 3: 84,190,851 Y390F probably benign Het
Vmn1r17 T A 6: 57,360,538 I232F possibly damaging Het
Zfp30 A T 7: 29,793,390 K356N probably damaging Het
Other mutations in Ermard
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ermard APN 17 14988066 splice site probably benign
IGL01554:Ermard APN 17 15051593 missense possibly damaging 0.94
IGL01832:Ermard APN 17 15059849 missense probably damaging 0.98
IGL02045:Ermard APN 17 15051564 unclassified probably benign
IGL02332:Ermard APN 17 14990545 critical splice acceptor site probably null
IGL02525:Ermard APN 17 15059339 splice site probably benign
IGL03335:Ermard APN 17 15059406 missense probably damaging 1.00
Eminence UTSW 17 15053205 splice site probably null
PIT4504001:Ermard UTSW 17 15058822 nonsense probably null
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0722:Ermard UTSW 17 15022128 missense probably benign 0.13
R0785:Ermard UTSW 17 15021977 missense probably damaging 1.00
R2019:Ermard UTSW 17 15053265 missense probably damaging 1.00
R3697:Ermard UTSW 17 15053376 missense probably benign 0.01
R4077:Ermard UTSW 17 15053376 missense probably benign 0.04
R4383:Ermard UTSW 17 15059866 missense possibly damaging 0.87
R5424:Ermard UTSW 17 15059770 missense possibly damaging 0.73
R6313:Ermard UTSW 17 15053205 splice site probably null
R7685:Ermard UTSW 17 15059462 missense probably benign 0.00
R7800:Ermard UTSW 17 15056803 missense probably benign 0.01
R7802:Ermard UTSW 17 15061161 missense probably benign
R7895:Ermard UTSW 17 15063613 missense possibly damaging 0.66
R7978:Ermard UTSW 17 15063613 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCCAAGAACTGCCAGGATAC -3'
(R):5'- GCTTCAGAACCCAGACTTTTAGAG -3'

Sequencing Primer
(F):5'- GAACACTGACAGAATGTTTCTCTGTC -3'
(R):5'- CCCAGACTTTTAGAGAATGTACAC -3'
Posted On2015-03-18