Incidental Mutation 'R3697:Arhgef4'
ID269841
Institutional Source Beutler Lab
Gene Symbol Arhgef4
Ensembl Gene ENSMUSG00000037509
Gene NameRho guanine nucleotide exchange factor (GEF) 4
Synonyms9330140K16Rik, Asef
MMRRC Submission 040691-MU
Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3697 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location34678188-34813309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34722440 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 259 (D259G)
Ref Sequence ENSEMBL: ENSMUSP00000124213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159747]
Predicted Effect unknown
Transcript: ENSMUST00000159747
AA Change: D259G
SMART Domains Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: D259G

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 686 712 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1119 1137 N/A INTRINSIC
low complexity region 1240 1254 N/A INTRINSIC
SH3 1361 1416 3.73e-16 SMART
RhoGEF 1453 1632 3.86e-56 SMART
PH 1665 1773 2.33e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Clcn3 T C 8: 60,913,123 D805G probably benign Het
Cnmd C A 14: 79,637,981 R333L probably damaging Het
Col4a4 A T 1: 82,541,237 I79N unknown Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Ermard T C 17: 15,053,376 S408P probably benign Het
Gls C T 1: 52,199,764 M364I possibly damaging Het
Gm16380 A G 9: 53,884,452 noncoding transcript Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Itga3 T C 11: 95,062,725 T233A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Miga1 T C 3: 152,322,436 N152S probably damaging Het
Nckipsd G A 9: 108,811,121 G83S probably damaging Het
Nedd4 T C 9: 72,740,187 F728L probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Nop56 C A 2: 130,277,587 N57K probably damaging Het
Nup205 A G 6: 35,188,711 N197S probably benign Het
Pglyrp3 T A 3: 92,028,174 C244S probably damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Rtp3 T A 9: 110,987,194 R96S possibly damaging Het
Serpinb8 A T 1: 107,607,146 K316* probably null Het
Sp6 C A 11: 97,021,754 P98T possibly damaging Het
Vmn1r15 A T 6: 57,258,336 D63V possibly damaging Het
Vmn1r216 G A 13: 23,099,679 W177* probably null Het
Zfp414 CAAACTCTTCCGA CAAACTCTTCCGAAACTCTTCCGA 17: 33,630,577 probably null Het
Other mutations in Arhgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Arhgef4 APN 1 34811696 missense possibly damaging 0.88
IGL02376:Arhgef4 APN 1 34806059 missense probably damaging 1.00
IGL02604:Arhgef4 APN 1 34811723 nonsense probably null
IGL03240:Arhgef4 APN 1 34806026 missense probably benign 0.03
R0095:Arhgef4 UTSW 1 34732370 nonsense probably null
R0157:Arhgef4 UTSW 1 34806394 missense probably damaging 1.00
R0243:Arhgef4 UTSW 1 34806999 intron probably null
R0383:Arhgef4 UTSW 1 34810533 missense probably damaging 1.00
R0440:Arhgef4 UTSW 1 34745448 splice site probably null
R0452:Arhgef4 UTSW 1 34732322 missense probably damaging 0.97
R0893:Arhgef4 UTSW 1 34807110 missense probably damaging 1.00
R1429:Arhgef4 UTSW 1 34810339 missense probably damaging 1.00
R1437:Arhgef4 UTSW 1 34723945 missense unknown
R1669:Arhgef4 UTSW 1 34732158 missense possibly damaging 0.86
R1780:Arhgef4 UTSW 1 34724160 missense possibly damaging 0.73
R1809:Arhgef4 UTSW 1 34810555 critical splice donor site probably null
R1879:Arhgef4 UTSW 1 34722440 missense unknown
R1908:Arhgef4 UTSW 1 34724259 missense probably benign 0.01
R1919:Arhgef4 UTSW 1 34811140 missense probably damaging 0.98
R2020:Arhgef4 UTSW 1 34723810 missense unknown
R2058:Arhgef4 UTSW 1 34722377 missense unknown
R2213:Arhgef4 UTSW 1 34807149 unclassified probably null
R2851:Arhgef4 UTSW 1 34724048 missense unknown
R2852:Arhgef4 UTSW 1 34724048 missense unknown
R2853:Arhgef4 UTSW 1 34724048 missense unknown
R4012:Arhgef4 UTSW 1 34725106 missense possibly damaging 0.75
R4118:Arhgef4 UTSW 1 34732347 missense probably damaging 0.98
R4133:Arhgef4 UTSW 1 34806104 missense probably damaging 1.00
R4534:Arhgef4 UTSW 1 34723081 missense unknown
R4535:Arhgef4 UTSW 1 34723081 missense unknown
R4581:Arhgef4 UTSW 1 34732124 missense possibly damaging 0.83
R4665:Arhgef4 UTSW 1 34806032 missense possibly damaging 0.89
R4678:Arhgef4 UTSW 1 34722668 missense unknown
R4684:Arhgef4 UTSW 1 34811785 unclassified probably null
R4706:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
R4745:Arhgef4 UTSW 1 34807275 missense probably damaging 1.00
R4747:Arhgef4 UTSW 1 34723274 missense unknown
R4988:Arhgef4 UTSW 1 34723454 missense unknown
R5063:Arhgef4 UTSW 1 34724215 missense probably benign 0.00
R5154:Arhgef4 UTSW 1 34732374 missense probably benign 0.43
R5156:Arhgef4 UTSW 1 34723274 missense unknown
R5263:Arhgef4 UTSW 1 34724997 missense possibly damaging 0.84
R5450:Arhgef4 UTSW 1 34807324 intron probably benign
R5807:Arhgef4 UTSW 1 34807615 intron probably benign
R5863:Arhgef4 UTSW 1 34722845 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6311:Arhgef4 UTSW 1 34723981 missense unknown
R6315:Arhgef4 UTSW 1 34723477 missense unknown
R6316:Arhgef4 UTSW 1 34723477 missense unknown
R6318:Arhgef4 UTSW 1 34723477 missense unknown
R6323:Arhgef4 UTSW 1 34723477 missense unknown
R6324:Arhgef4 UTSW 1 34723477 missense unknown
R6325:Arhgef4 UTSW 1 34723477 missense unknown
R6340:Arhgef4 UTSW 1 34732223 missense probably damaging 1.00
R6835:Arhgef4 UTSW 1 34806493 missense probably damaging 1.00
R6981:Arhgef4 UTSW 1 34722452 missense unknown
R7087:Arhgef4 UTSW 1 34811686 missense probably damaging 0.96
R7297:Arhgef4 UTSW 1 34807192 missense probably damaging 1.00
R7525:Arhgef4 UTSW 1 34809704 missense probably damaging 1.00
R7614:Arhgef4 UTSW 1 34732235 missense possibly damaging 0.67
R7693:Arhgef4 UTSW 1 34724141 missense probably benign 0.01
RF012:Arhgef4 UTSW 1 34724484 small deletion probably benign
X0062:Arhgef4 UTSW 1 34724227 missense probably benign 0.35
YA93:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTCGTCGACACTGTGAACTAG -3'
(R):5'- CCGCAAGTAGGGCCAATTTG -3'

Sequencing Primer
(F):5'- CGTCGACACTGTGAACTAGGTCAG -3'
(R):5'- GCTTCAGAGGCTCTTTAGGACAAC -3'
Posted On2015-03-18