Incidental Mutation 'R3697:Miga1'
ID269849
Institutional Source Beutler Lab
Gene Symbol Miga1
Ensembl Gene ENSMUSG00000054942
Gene Namemitoguardin 1
SynonymsC030011O14Rik
MMRRC Submission 040691-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3697 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location152273849-152340407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152322436 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 152 (N152S)
Ref Sequence ENSEMBL: ENSMUSP00000143238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068243] [ENSMUST00000073089] [ENSMUST00000196265] [ENSMUST00000199334]
Predicted Effect probably damaging
Transcript: ENSMUST00000068243
AA Change: N152S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068261
Gene: ENSMUSG00000054942
AA Change: N152S

DomainStartEndE-ValueType
Pfam:DUF2217 26 306 6.3e-74 PFAM
Pfam:DUF2217 298 507 2.8e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073089
AA Change: N152S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072836
Gene: ENSMUSG00000054942
AA Change: N152S

DomainStartEndE-ValueType
Pfam:DUF2217 27 571 4.8e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196265
SMART Domains Protein: ENSMUSP00000142667
Gene: ENSMUSG00000054942

DomainStartEndE-ValueType
Pfam:DUF2217 26 146 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199334
AA Change: N152S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143238
Gene: ENSMUSG00000054942
AA Change: N152S

DomainStartEndE-ValueType
Pfam:DUF2217 26 496 1.2e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199443
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Arhgef4 A G 1: 34,722,440 D259G unknown Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Clcn3 T C 8: 60,913,123 D805G probably benign Het
Cnmd C A 14: 79,637,981 R333L probably damaging Het
Col4a4 A T 1: 82,541,237 I79N unknown Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Ermard T C 17: 15,053,376 S408P probably benign Het
Gls C T 1: 52,199,764 M364I possibly damaging Het
Gm16380 A G 9: 53,884,452 noncoding transcript Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Itga3 T C 11: 95,062,725 T233A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Nckipsd G A 9: 108,811,121 G83S probably damaging Het
Nedd4 T C 9: 72,740,187 F728L probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Nop56 C A 2: 130,277,587 N57K probably damaging Het
Nup205 A G 6: 35,188,711 N197S probably benign Het
Pglyrp3 T A 3: 92,028,174 C244S probably damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Rtp3 T A 9: 110,987,194 R96S possibly damaging Het
Serpinb8 A T 1: 107,607,146 K316* probably null Het
Sp6 C A 11: 97,021,754 P98T possibly damaging Het
Vmn1r15 A T 6: 57,258,336 D63V possibly damaging Het
Vmn1r216 G A 13: 23,099,679 W177* probably null Het
Zfp414 CAAACTCTTCCGA CAAACTCTTCCGAAACTCTTCCGA 17: 33,630,577 probably null Het
Other mutations in Miga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Miga1 APN 3 152276690 missense probably benign 0.18
IGL01461:Miga1 APN 3 152335297 missense probably damaging 1.00
IGL02962:Miga1 APN 3 152285341 splice site probably benign
R0165:Miga1 UTSW 3 152290843 missense probably damaging 0.99
R0945:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1527:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1769:Miga1 UTSW 3 152287554 missense probably damaging 1.00
R1978:Miga1 UTSW 3 152335304 frame shift probably null
R4649:Miga1 UTSW 3 152279005 missense probably benign 0.28
R4660:Miga1 UTSW 3 152287518 missense probably damaging 1.00
R4679:Miga1 UTSW 3 152322475 missense probably damaging 1.00
R4815:Miga1 UTSW 3 152290806 missense probably benign 0.00
R5019:Miga1 UTSW 3 152322461 missense possibly damaging 0.86
R5488:Miga1 UTSW 3 152333446 small deletion probably benign
R6107:Miga1 UTSW 3 152335399 missense probably benign 0.03
R6227:Miga1 UTSW 3 152278949 missense probably benign 0.09
R6292:Miga1 UTSW 3 152317719 missense probably benign 0.30
R6438:Miga1 UTSW 3 152322403 missense probably damaging 1.00
R6444:Miga1 UTSW 3 152283831 missense probably damaging 1.00
R6489:Miga1 UTSW 3 152279008 missense probably damaging 0.99
R6564:Miga1 UTSW 3 152285322 missense probably damaging 1.00
R7354:Miga1 UTSW 3 152290500 missense probably damaging 1.00
R7440:Miga1 UTSW 3 152338046 critical splice acceptor site probably null
R7638:Miga1 UTSW 3 152276687 missense probably benign 0.00
R8039:Miga1 UTSW 3 152276756 missense probably benign 0.15
R8154:Miga1 UTSW 3 152320700 unclassified probably benign
R8418:Miga1 UTSW 3 152285317 missense probably damaging 1.00
R8423:Miga1 UTSW 3 152322408 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATGCCAGGCAAGTTCTTTG -3'
(R):5'- AGCAGATTTGGCATGGACTTC -3'

Sequencing Primer
(F):5'- CCAGGCAAGTTCTTTGTGCTAAGC -3'
(R):5'- TAGCATGCCTGAAACTCTGG -3'
Posted On2015-03-18