Incidental Mutation 'R3697:Sp6'
ID 269866
Institutional Source Beutler Lab
Gene Symbol Sp6
Ensembl Gene ENSMUSG00000038560
Gene Name trans-acting transcription factor 6
Synonyms Epfn, Klf14, epiprofin, 1110025J03Rik
MMRRC Submission 040691-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R3697 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 96904395-96915565 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 96912580 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 98 (P98T)
Ref Sequence ENSEMBL: ENSMUSP00000103248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047997] [ENSMUST00000107622]
AlphaFold Q9ESX2
Predicted Effect possibly damaging
Transcript: ENSMUST00000047997
AA Change: P98T

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039307
Gene: ENSMUSG00000038560
AA Change: P98T

DomainStartEndE-ValueType
low complexity region 163 177 N/A INTRINSIC
ZnF_C2H2 254 278 3.99e0 SMART
ZnF_C2H2 284 308 2.99e-4 SMART
ZnF_C2H2 314 336 3.16e-3 SMART
low complexity region 337 364 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107622
AA Change: P98T

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103248
Gene: ENSMUSG00000038560
AA Change: P98T

DomainStartEndE-ValueType
low complexity region 163 177 N/A INTRINSIC
ZnF_C2H2 254 278 3.99e0 SMART
ZnF_C2H2 284 308 2.99e-4 SMART
ZnF_C2H2 314 336 3.16e-3 SMART
low complexity region 337 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128111
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SP6 belongs to a family of transcription factors that contain 3 classical zinc finger DNA-binding domains consisting of a zinc atom tetrahedrally coordinated by 2 cysteines and 2 histidines (C2H2 motif). These transcription factors bind to GC-rich sequences and related GT and CACCC boxes (Scohy et al., 2000 [PubMed 11087666]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a disruption at this locus display impaired skin, hair follicle, tooth and lung development as well as limb abnormalities and partial postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,369,562 (GRCm39) H371R possibly damaging Het
Arhgef4 A G 1: 34,761,521 (GRCm39) D259G unknown Het
Bckdk C A 7: 127,504,590 (GRCm39) R105S probably damaging Het
Clcn3 T C 8: 61,366,157 (GRCm39) D805G probably benign Het
Cnmd C A 14: 79,875,421 (GRCm39) R333L probably damaging Het
Col4a4 A T 1: 82,518,958 (GRCm39) I79N unknown Het
Emc1 T G 4: 139,092,697 (GRCm39) S546A possibly damaging Het
Ermard T C 17: 15,273,638 (GRCm39) S408P probably benign Het
Gls C T 1: 52,238,923 (GRCm39) M364I possibly damaging Het
Gm16380 A G 9: 53,791,736 (GRCm39) noncoding transcript Het
Il12a TCAC TC 3: 68,605,320 (GRCm39) probably null Het
Il6st T G 13: 112,640,916 (GRCm39) D897E probably benign Het
Itga3 T C 11: 94,953,551 (GRCm39) T233A probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,814,432 (GRCm39) probably benign Het
Miga1 T C 3: 152,028,073 (GRCm39) N152S probably damaging Het
Nckipsd G A 9: 108,688,320 (GRCm39) G83S probably damaging Het
Nedd4 T C 9: 72,647,469 (GRCm39) F728L probably damaging Het
Nid1 G A 13: 13,661,344 (GRCm39) C748Y probably damaging Het
Nop56 C A 2: 130,119,507 (GRCm39) N57K probably damaging Het
Nup205 A G 6: 35,165,646 (GRCm39) N197S probably benign Het
Pglyrp3 T A 3: 91,935,481 (GRCm39) C244S probably damaging Het
Rgs22 C T 15: 36,100,038 (GRCm39) V226I probably benign Het
Rtp3 T A 9: 110,816,262 (GRCm39) R96S possibly damaging Het
Serpinb8 A T 1: 107,534,876 (GRCm39) K316* probably null Het
Vmn1r15 A T 6: 57,235,321 (GRCm39) D63V possibly damaging Het
Vmn1r216 G A 13: 23,283,849 (GRCm39) W177* probably null Het
Zfp414 CAAACTCTTCCGA CAAACTCTTCCGAAACTCTTCCGA 17: 33,849,551 (GRCm39) probably null Het
Other mutations in Sp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sp6 APN 11 96,913,429 (GRCm39) utr 3 prime probably benign
R0281:Sp6 UTSW 11 96,912,751 (GRCm39) missense probably benign 0.24
R0326:Sp6 UTSW 11 96,912,361 (GRCm39) missense possibly damaging 0.90
R0584:Sp6 UTSW 11 96,913,091 (GRCm39) missense probably damaging 1.00
R0678:Sp6 UTSW 11 96,912,607 (GRCm39) missense probably damaging 0.99
R0690:Sp6 UTSW 11 96,912,370 (GRCm39) missense possibly damaging 0.89
R1909:Sp6 UTSW 11 96,912,334 (GRCm39) missense probably benign 0.04
R1950:Sp6 UTSW 11 96,912,940 (GRCm39) missense probably benign 0.14
R4380:Sp6 UTSW 11 96,912,572 (GRCm39) missense probably damaging 0.98
R4666:Sp6 UTSW 11 96,912,701 (GRCm39) missense probably benign 0.19
R8701:Sp6 UTSW 11 96,913,090 (GRCm39) missense probably damaging 1.00
X0011:Sp6 UTSW 11 96,913,351 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAATGCTAACCGCTGTCTGTG -3'
(R):5'- GACGTATCCTCCCAAAGCAG -3'

Sequencing Primer
(F):5'- TCTCCAGACATACCAGGGTC -3'
(R):5'- TATCCTCCCAAAGCAGGCTGAAG -3'
Posted On 2015-03-18