Incidental Mutation 'R3697:Zfp414'
ID 269874
Institutional Source Beutler Lab
Gene Symbol Zfp414
Ensembl Gene ENSMUSG00000073423
Gene Name zinc finger protein 414
Synonyms
MMRRC Submission 040691-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock # R3697 (G1)
Quality Score 198
Status Not validated
Chromosome 17
Chromosomal Location 33629090-33631779 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CAAACTCTTCCGA to CAAACTCTTCCGAAACTCTTCCGA at 33630577 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073570] [ENSMUST00000165504] [ENSMUST00000166627] [ENSMUST00000170225]
AlphaFold Q9DCK4
Predicted Effect probably null
Transcript: ENSMUST00000073570
SMART Domains Protein: ENSMUSP00000073259
Gene: ENSMUSG00000073423

DomainStartEndE-ValueType
low complexity region 86 95 N/A INTRINSIC
ZnF_C2H2 99 123 1.01e-1 SMART
ZnF_C2H2 135 159 7.49e0 SMART
ZnF_C2H2 166 191 2.61e1 SMART
low complexity region 195 231 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164636
Predicted Effect probably benign
Transcript: ENSMUST00000165504
Predicted Effect probably null
Transcript: ENSMUST00000166627
SMART Domains Protein: ENSMUSP00000129423
Gene: ENSMUSG00000073423

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
ZnF_C2H2 50 74 1.01e-1 SMART
ZnF_C2H2 86 110 7.49e0 SMART
ZnF_C2H2 117 142 2.61e1 SMART
low complexity region 146 182 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169781
Predicted Effect probably null
Transcript: ENSMUST00000170225
SMART Domains Protein: ENSMUSP00000127118
Gene: ENSMUSG00000073423

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
ZnF_C2H2 50 74 1.01e-1 SMART
ZnF_C2H2 86 110 7.49e0 SMART
ZnF_C2H2 117 142 2.61e1 SMART
low complexity region 146 182 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172455
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Arhgef4 A G 1: 34,722,440 D259G unknown Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Clcn3 T C 8: 60,913,123 D805G probably benign Het
Cnmd C A 14: 79,637,981 R333L probably damaging Het
Col4a4 A T 1: 82,541,237 I79N unknown Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Ermard T C 17: 15,053,376 S408P probably benign Het
Gls C T 1: 52,199,764 M364I possibly damaging Het
Gm16380 A G 9: 53,884,452 noncoding transcript Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Itga3 T C 11: 95,062,725 T233A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Miga1 T C 3: 152,322,436 N152S probably damaging Het
Nckipsd G A 9: 108,811,121 G83S probably damaging Het
Nedd4 T C 9: 72,740,187 F728L probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Nop56 C A 2: 130,277,587 N57K probably damaging Het
Nup205 A G 6: 35,188,711 N197S probably benign Het
Pglyrp3 T A 3: 92,028,174 C244S probably damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Rtp3 T A 9: 110,987,194 R96S possibly damaging Het
Serpinb8 A T 1: 107,607,146 K316* probably null Het
Sp6 C A 11: 97,021,754 P98T possibly damaging Het
Vmn1r15 A T 6: 57,258,336 D63V possibly damaging Het
Vmn1r216 G A 13: 23,099,679 W177* probably null Het
Other mutations in Zfp414
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1277:Zfp414 UTSW 17 33630475 critical splice donor site probably null
R1453:Zfp414 UTSW 17 33630038 missense probably damaging 1.00
R2473:Zfp414 UTSW 17 33630577 frame shift probably null
R4545:Zfp414 UTSW 17 33631648 unclassified probably benign
R5610:Zfp414 UTSW 17 33630038 missense probably damaging 1.00
R7265:Zfp414 UTSW 17 33631279 missense probably benign 0.02
R7836:Zfp414 UTSW 17 33629988 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCAGTGTTCGTGATCTAGC -3'
(R):5'- ACGGCATGTATACCCTGCAC -3'

Sequencing Primer
(F):5'- CAGTGTTCGTGATCTAGCACAGC -3'
(R):5'- GCCAGAATGACTTAATTCCCATCTG -3'
Posted On 2015-03-18