Incidental Mutation 'R3698:Il12a'
ID269880
Institutional Source Beutler Lab
Gene Symbol Il12a
Ensembl Gene ENSMUSG00000027776
Gene Nameinterleukin 12a
SynonymsIL-12p35, p35
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3698 (G1)
Quality Score217
Status Not validated
Chromosome3
Chromosomal Location68690644-68698547 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCAC to TC at 68697987 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029345] [ENSMUST00000107816]
Predicted Effect probably null
Transcript: ENSMUST00000029345
SMART Domains Protein: ENSMUSP00000029345
Gene: ENSMUSG00000027776

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
Pfam:IL12 27 236 2.5e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107816
SMART Domains Protein: ENSMUSP00000103446
Gene: ENSMUSG00000027776

DomainStartEndE-ValueType
Pfam:IL12 1 215 6.8e-128 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195517
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes have decreased NK cell responses, altered effector T cell differentiation, and increased susceptibility to parasitic infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 C A 19: 56,916,523 S549I possibly damaging Het
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Arpc1a G T 5: 145,096,191 K103N probably damaging Het
Btg3 A G 16: 78,364,834 S136P probably benign Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Fam45a A G 19: 60,832,616 probably null Het
G3bp2 T C 5: 92,056,280 E316G possibly damaging Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo13 A G 4: 117,900,693 L767P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl13 G A X: 23,248,183 T94I probably benign Het
Morc2a A T 11: 3,679,672 K364* probably null Het
Nat8f2 T A 6: 85,867,796 T195S probably benign Het
Nckipsd G A 9: 108,811,121 G83S probably damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Slc13a4 T A 6: 35,274,957 I467F probably benign Het
Stat2 T A 10: 128,278,793 L253Q probably benign Het
Tnxb G T 17: 34,690,433 probably null Het
Ttn C T 2: 76,734,251 R28514H probably damaging Het
Usp15 T C 10: 123,181,738 D51G probably damaging Het
Uvrag T C 7: 98,939,943 E417G probably damaging Het
Other mutations in Il12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Il12a APN 3 68691555 missense possibly damaging 0.96
IGL01820:Il12a APN 3 68692162 splice site probably benign
IGL01989:Il12a APN 3 68691576 splice site probably benign
bakers_dozen UTSW 3 68697987 frame shift probably null
R0388:Il12a UTSW 3 68695187 splice site probably null
R0646:Il12a UTSW 3 68697890 splice site probably benign
R1083:Il12a UTSW 3 68695333 missense probably damaging 1.00
R1588:Il12a UTSW 3 68695563 missense probably benign 0.04
R2240:Il12a UTSW 3 68694184 nonsense probably null
R2909:Il12a UTSW 3 68697987 frame shift probably null
R2925:Il12a UTSW 3 68697987 frame shift probably null
R3696:Il12a UTSW 3 68697987 frame shift probably null
R3697:Il12a UTSW 3 68697987 frame shift probably null
R4332:Il12a UTSW 3 68695261 intron probably benign
R5809:Il12a UTSW 3 68695262 intron probably benign
R6279:Il12a UTSW 3 68697979 missense probably damaging 0.96
R6305:Il12a UTSW 3 68694178 missense possibly damaging 0.80
R6847:Il12a UTSW 3 68695566 missense probably damaging 1.00
R7751:Il12a UTSW 3 68697902 missense probably damaging 1.00
R8188:Il12a UTSW 3 68691539 missense unknown
R8339:Il12a UTSW 3 68692105 nonsense probably null
RF003:Il12a UTSW 3 68695229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACTTTGCATTGACTGTCTCC -3'
(R):5'- AGGTAGCTGTGCCACCTTTG -3'

Sequencing Primer
(F):5'- GACTGTCTCCCATTTTGCAGACAAAC -3'
(R):5'- CCACCTTTGGGGAGATGAG -3'
Posted On2015-03-18