Incidental Mutation 'R3698:Arpc1a'
ID269886
Institutional Source Beutler Lab
Gene Symbol Arpc1a
Ensembl Gene ENSMUSG00000029621
Gene Nameactin related protein 2/3 complex, subunit 1A
SynonymsSid32, 0610010H08Rik, 1110030K07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R3698 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145083830-145108761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 145096191 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 103 (K103N)
Ref Sequence ENSEMBL: ENSMUSP00000114421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031625] [ENSMUST00000124379] [ENSMUST00000127694]
Predicted Effect probably damaging
Transcript: ENSMUST00000031625
AA Change: K103N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031625
Gene: ENSMUSG00000029621
AA Change: K103N

DomainStartEndE-ValueType
Blast:WD40 1 36 1e-18 BLAST
WD40 41 80 2.55e-6 SMART
WD40 89 124 1.1e2 SMART
WD40 134 170 1.46e-1 SMART
WD40 191 232 4.62e-1 SMART
WD40 235 273 9.51e1 SMART
WD40 312 356 3.68e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124379
AA Change: K103N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114421
Gene: ENSMUSG00000029621
AA Change: K103N

DomainStartEndE-ValueType
Blast:WD40 1 36 2e-19 BLAST
WD40 41 80 2.55e-6 SMART
WD40 89 124 1.1e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127694
AA Change: K103N

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143026
Gene: ENSMUSG00000029621
AA Change: K103N

DomainStartEndE-ValueType
Blast:WD40 1 36 2e-18 BLAST
WD40 41 80 1.6e-8 SMART
WD40 89 124 6.8e-1 SMART
WD40 134 170 8.9e-4 SMART
WD40 191 232 2.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147564
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1B. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 C A 19: 56,916,523 S549I possibly damaging Het
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Btg3 A G 16: 78,364,834 S136P probably benign Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Fam45a A G 19: 60,832,616 probably null Het
G3bp2 T C 5: 92,056,280 E316G possibly damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo13 A G 4: 117,900,693 L767P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl13 G A X: 23,248,183 T94I probably benign Het
Morc2a A T 11: 3,679,672 K364* probably null Het
Nat8f2 T A 6: 85,867,796 T195S probably benign Het
Nckipsd G A 9: 108,811,121 G83S probably damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Slc13a4 T A 6: 35,274,957 I467F probably benign Het
Stat2 T A 10: 128,278,793 L253Q probably benign Het
Tnxb G T 17: 34,690,433 probably null Het
Ttn C T 2: 76,734,251 R28514H probably damaging Het
Usp15 T C 10: 123,181,738 D51G probably damaging Het
Uvrag T C 7: 98,939,943 E417G probably damaging Het
Other mutations in Arpc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Arpc1a APN 5 145096154 missense probably damaging 1.00
IGL02672:Arpc1a APN 5 145104887 missense probably damaging 0.99
R0068:Arpc1a UTSW 5 145091244 missense possibly damaging 0.62
R0068:Arpc1a UTSW 5 145091244 missense possibly damaging 0.62
R1347:Arpc1a UTSW 5 145097272 missense probably damaging 1.00
R1347:Arpc1a UTSW 5 145097272 missense probably damaging 1.00
R1446:Arpc1a UTSW 5 145101086 splice site probably null
R1870:Arpc1a UTSW 5 145107091 missense possibly damaging 0.80
R1871:Arpc1a UTSW 5 145107091 missense possibly damaging 0.80
R2154:Arpc1a UTSW 5 145092559 missense probably benign 0.33
R2385:Arpc1a UTSW 5 145104523 splice site probably null
R6462:Arpc1a UTSW 5 145108387 missense probably benign 0.01
R6720:Arpc1a UTSW 5 145101222 splice site probably null
R6825:Arpc1a UTSW 5 145096126 nonsense probably null
R7174:Arpc1a UTSW 5 145097277 missense probably benign 0.38
R7473:Arpc1a UTSW 5 145101076 missense probably benign
R7619:Arpc1a UTSW 5 145104858 missense probably benign 0.36
R7775:Arpc1a UTSW 5 145104812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGCAAGTGACCTGTGCTTC -3'
(R):5'- TGAGTCATGCACATACGAGTTG -3'

Sequencing Primer
(F):5'- CAAGTGACCTGTGCTTCACTTTTAGG -3'
(R):5'- GGCACTGCAGTACACAGAGC -3'
Posted On2015-03-18