Incidental Mutation 'R3698:Usp15'
ID269893
Institutional Source Beutler Lab
Gene Symbol Usp15
Ensembl Gene ENSMUSG00000020124
Gene Nameubiquitin specific peptidase 15
SynonymsGcap18, 4921514G19Rik, E430033I05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3698 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location123105006-123196995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123181738 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 51 (D51G)
Ref Sequence ENSEMBL: ENSMUSP00000151244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020334] [ENSMUST00000220377]
Predicted Effect probably damaging
Transcript: ENSMUST00000020334
AA Change: D51G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020334
Gene: ENSMUSG00000020124
AA Change: D51G

DomainStartEndE-ValueType
DUSP 23 121 1.5e-46 SMART
Pfam:Ubiquitin_3 135 222 3.7e-38 PFAM
low complexity region 242 262 N/A INTRINSIC
Pfam:UCH 288 930 6.8e-86 PFAM
Pfam:UCH_1 289 506 1.1e-5 PFAM
Pfam:USP7_C2 460 608 2e-7 PFAM
Pfam:UCH_1 756 912 1.3e-11 PFAM
low complexity region 959 976 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219010
Predicted Effect unknown
Transcript: ENSMUST00000219619
AA Change: D54G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220284
Predicted Effect probably damaging
Transcript: ENSMUST00000220377
AA Change: D51G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the large ubiquitin specific protease (Usp) family of proteins. These proteins are known to cleave ubiquitin, and contain a conserved cysteine residue (Cys box) and two conserved histidine residues (His box) that are thought to form part of the active site of the protease. This protein has been shown to cleave both the ubiquitin-proline and the ubiquitin-methionine bonds in vitro. This protein is thought to regulate many cellular processes through its deubiquitination activity, including the transforming growth factor beta (TGF-beta) pathway. Cardiac-specific overexpression of the human ortholog of this gene in mice causes enlargement of the heart that is more pronounced in the atrium than in the ventricle. This gene has two pseudogenes on chromosome 14. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms.[provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele or ENU induced allele exhibit resistance to pathological neuroinflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 C A 19: 56,916,523 S549I possibly damaging Het
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Arpc1a G T 5: 145,096,191 K103N probably damaging Het
Btg3 A G 16: 78,364,834 S136P probably benign Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Fam45a A G 19: 60,832,616 probably null Het
G3bp2 T C 5: 92,056,280 E316G possibly damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo13 A G 4: 117,900,693 L767P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl13 G A X: 23,248,183 T94I probably benign Het
Morc2a A T 11: 3,679,672 K364* probably null Het
Nat8f2 T A 6: 85,867,796 T195S probably benign Het
Nckipsd G A 9: 108,811,121 G83S probably damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Slc13a4 T A 6: 35,274,957 I467F probably benign Het
Stat2 T A 10: 128,278,793 L253Q probably benign Het
Tnxb G T 17: 34,690,433 probably null Het
Ttn C T 2: 76,734,251 R28514H probably damaging Het
Uvrag T C 7: 98,939,943 E417G probably damaging Het
Other mutations in Usp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Usp15 APN 10 123113596 missense probably benign 0.00
IGL02148:Usp15 APN 10 123127837 missense probably damaging 1.00
IGL02737:Usp15 APN 10 123131032 missense probably damaging 1.00
IGL03054:Usp15 APN 10 123125931 splice site probably benign
IGL03163:Usp15 APN 10 123171144 missense probably damaging 0.96
R1755:Usp15 UTSW 10 123133044 missense probably damaging 0.98
R1981:Usp15 UTSW 10 123125041 splice site probably benign
R2049:Usp15 UTSW 10 123119137 missense probably damaging 1.00
R3037:Usp15 UTSW 10 123163617 missense probably damaging 1.00
R3828:Usp15 UTSW 10 123196870 missense possibly damaging 0.95
R3845:Usp15 UTSW 10 123119135 missense probably damaging 1.00
R4838:Usp15 UTSW 10 123127757 missense probably damaging 0.99
R4954:Usp15 UTSW 10 123131398 missense probably damaging 1.00
R5204:Usp15 UTSW 10 123113640 missense probably benign 0.06
R5274:Usp15 UTSW 10 123168351 missense probably damaging 1.00
R5387:Usp15 UTSW 10 123131286 missense probably damaging 0.96
R5474:Usp15 UTSW 10 123128045 missense probably damaging 1.00
R5501:Usp15 UTSW 10 123175899 missense probably damaging 0.99
R5665:Usp15 UTSW 10 123130987 nonsense probably null
R5846:Usp15 UTSW 10 123181742 missense probably damaging 1.00
R5850:Usp15 UTSW 10 123124512 critical splice donor site probably null
R6163:Usp15 UTSW 10 123168305 missense probably damaging 1.00
R6735:Usp15 UTSW 10 123168367 missense possibly damaging 0.86
R6828:Usp15 UTSW 10 123127989 missense probably damaging 1.00
R7170:Usp15 UTSW 10 123171195 missense probably damaging 1.00
R7197:Usp15 UTSW 10 123131005 missense possibly damaging 0.92
R7351:Usp15 UTSW 10 123132999 missense probably damaging 1.00
R7368:Usp15 UTSW 10 123196893 missense possibly damaging 0.86
R7447:Usp15 UTSW 10 123175881 missense probably damaging 1.00
R8099:Usp15 UTSW 10 123146921 missense possibly damaging 0.87
R8169:Usp15 UTSW 10 123125893 missense
R8316:Usp15 UTSW 10 123123943 missense
R8795:Usp15 UTSW 10 123153048 missense probably benign 0.00
Z1176:Usp15 UTSW 10 123196961 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTGTGCTACCTACCATACTTACAAC -3'
(R):5'- GGCTGTAACCACACAGTACTC -3'

Sequencing Primer
(F):5'- CGAATTGCTAACTACCAGCTTATC -3'
(R):5'- ACTCTTGTTCTTAGTCCCTGGAAGG -3'
Posted On2015-03-18