Incidental Mutation 'R3698:Btg3'
ID269899
Institutional Source Beutler Lab
Gene Symbol Btg3
Ensembl Gene ENSMUSG00000022863
Gene NameB cell translocation gene 3
Synonymstob5, ANA
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R3698 (G1)
Quality Score204
Status Not validated
Chromosome16
Chromosomal Location78332637-78377192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78364834 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 136 (S136P)
Ref Sequence ENSEMBL: ENSMUSP00000156138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023570] [ENSMUST00000148124] [ENSMUST00000231353]
Predicted Effect probably benign
Transcript: ENSMUST00000023570
AA Change: S163P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023570
Gene: ENSMUSG00000022863
AA Change: S163P

DomainStartEndE-ValueType
btg1 1 108 1.28e-81 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 206 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148124
SMART Domains Protein: ENSMUSP00000119706
Gene: ENSMUSG00000022863

DomainStartEndE-ValueType
btg1 1 108 1.28e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231353
AA Change: S136P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes B cell translocation gene 3, a member of the BTG gene family. This family is defined by a conserved N-terminal domain, known to bind transcription factors, and a less conserved C-terminal domain. This protein is thought to have anti-proliferative properties, and may be involved in regulating the G1-S transition to suppress cell cycle progression. Mice deficient for this gene display an increased incidence of lung cancers, and many human lung cancer cells exhibit decreased levels of B cell translocation gene 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 C A 19: 56,916,523 S549I possibly damaging Het
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Arpc1a G T 5: 145,096,191 K103N probably damaging Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Fam45a A G 19: 60,832,616 probably null Het
G3bp2 T C 5: 92,056,280 E316G possibly damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo13 A G 4: 117,900,693 L767P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl13 G A X: 23,248,183 T94I probably benign Het
Morc2a A T 11: 3,679,672 K364* probably null Het
Nat8f2 T A 6: 85,867,796 T195S probably benign Het
Nckipsd G A 9: 108,811,121 G83S probably damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Slc13a4 T A 6: 35,274,957 I467F probably benign Het
Stat2 T A 10: 128,278,793 L253Q probably benign Het
Tnxb G T 17: 34,690,433 probably null Het
Ttn C T 2: 76,734,251 R28514H probably damaging Het
Usp15 T C 10: 123,181,738 D51G probably damaging Het
Uvrag T C 7: 98,939,943 E417G probably damaging Het
Other mutations in Btg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0578:Btg3 UTSW 16 78364946 missense probably benign 0.24
R1467:Btg3 UTSW 16 78364800 critical splice donor site probably null
R1467:Btg3 UTSW 16 78364800 critical splice donor site probably null
R2860:Btg3 UTSW 16 78364980 missense probably damaging 1.00
R2861:Btg3 UTSW 16 78364980 missense probably damaging 1.00
R2862:Btg3 UTSW 16 78364980 missense probably damaging 1.00
R6938:Btg3 UTSW 16 78360328 missense probably benign 0.01
R7336:Btg3 UTSW 16 78364807 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CCAGTTGCATCTCTGATAAGCAG -3'
(R):5'- TCATGTCCACCTAGGTATGGAG -3'

Sequencing Primer
(F):5'- AAGCAGCTTTCCACTAGTGTG -3'
(R):5'- TCCACCTAGGTATGGAGAGAAAAAC -3'
Posted On2015-03-18