Incidental Mutation 'R3698:Klhl13'
ID269903
Institutional Source Beutler Lab
Gene Symbol Klhl13
Ensembl Gene ENSMUSG00000036782
Gene Namekelch-like 13
SynonymsD130072F20Rik, Bklhd2, 1200009K10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R3698 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location23219271-23365082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23248183 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 94 (T94I)
Ref Sequence ENSEMBL: ENSMUSP00000110974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035973] [ENSMUST00000115313] [ENSMUST00000115316] [ENSMUST00000115317] [ENSMUST00000115319]
Predicted Effect probably benign
Transcript: ENSMUST00000035973
AA Change: T84I

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000041190
Gene: ENSMUSG00000036782
AA Change: T84I

DomainStartEndE-ValueType
BTB 75 174 6.43e-19 SMART
BACK 179 280 5.87e-26 SMART
Kelch 324 372 4.58e-3 SMART
Kelch 373 424 1.38e-6 SMART
Kelch 425 471 6.71e-10 SMART
Kelch 472 518 3.68e-7 SMART
Kelch 519 570 1.69e-6 SMART
Kelch 571 619 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115313
AA Change: T50I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110968
Gene: ENSMUSG00000036782
AA Change: T50I

DomainStartEndE-ValueType
BTB 41 140 6.43e-19 SMART
BACK 145 246 5.87e-26 SMART
Kelch 290 338 4.58e-3 SMART
Kelch 339 390 1.38e-6 SMART
Kelch 391 437 6.71e-10 SMART
Kelch 438 484 3.68e-7 SMART
Kelch 485 536 1.69e-6 SMART
Kelch 537 585 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115316
AA Change: T86I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110971
Gene: ENSMUSG00000036782
AA Change: T86I

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
BTB 77 176 6.43e-19 SMART
BACK 181 282 5.87e-26 SMART
Kelch 326 374 4.58e-3 SMART
Kelch 375 426 1.38e-6 SMART
Kelch 427 473 6.71e-10 SMART
Kelch 474 520 3.68e-7 SMART
Kelch 521 572 1.69e-6 SMART
Kelch 573 621 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115317
AA Change: T100I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110972
Gene: ENSMUSG00000036782
AA Change: T100I

DomainStartEndE-ValueType
BTB 91 190 6.43e-19 SMART
BACK 195 296 5.87e-26 SMART
Kelch 340 388 4.58e-3 SMART
Kelch 389 440 1.38e-6 SMART
Kelch 441 487 6.71e-10 SMART
Kelch 488 534 3.68e-7 SMART
Kelch 535 586 1.69e-6 SMART
Kelch 587 635 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115319
AA Change: T94I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110974
Gene: ENSMUSG00000036782
AA Change: T94I

DomainStartEndE-ValueType
BTB 85 184 6.43e-19 SMART
BACK 189 290 5.87e-26 SMART
Kelch 334 382 4.58e-3 SMART
Kelch 383 434 1.38e-6 SMART
Kelch 435 481 6.71e-10 SMART
Kelch 482 528 3.68e-7 SMART
Kelch 529 580 1.69e-6 SMART
Kelch 581 629 1.25e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153345
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a BTB and kelch domain containing protein and belongs to the kelch repeat domain containing superfamily of proteins. The encoded protein functions as an adaptor protein that complexes with Cullin 3 and other proteins to form the Cullin 3-based E3 ubiquitin-protein ligase complex. This complex is necessary for proper chromosome segregation and completion of cytokinesis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 C A 19: 56,916,523 S549I possibly damaging Het
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Arpc1a G T 5: 145,096,191 K103N probably damaging Het
Btg3 A G 16: 78,364,834 S136P probably benign Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Fam45a A G 19: 60,832,616 probably null Het
G3bp2 T C 5: 92,056,280 E316G possibly damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo13 A G 4: 117,900,693 L767P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Morc2a A T 11: 3,679,672 K364* probably null Het
Nat8f2 T A 6: 85,867,796 T195S probably benign Het
Nckipsd G A 9: 108,811,121 G83S probably damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Slc13a4 T A 6: 35,274,957 I467F probably benign Het
Stat2 T A 10: 128,278,793 L253Q probably benign Het
Tnxb G T 17: 34,690,433 probably null Het
Ttn C T 2: 76,734,251 R28514H probably damaging Het
Usp15 T C 10: 123,181,738 D51G probably damaging Het
Uvrag T C 7: 98,939,943 E417G probably damaging Het
Other mutations in Klhl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1951:Klhl13 UTSW X 23261581 splice site probably benign
R3873:Klhl13 UTSW X 23285176 missense probably benign 0.06
R3874:Klhl13 UTSW X 23285176 missense probably benign 0.06
R4241:Klhl13 UTSW X 23315175 missense probably damaging 0.99
R4242:Klhl13 UTSW X 23315175 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTCTGTGATTGTCCACTCAG -3'
(R):5'- GGCTCTGTTTTCAAAATACCCTAG -3'

Sequencing Primer
(F):5'- AGTCTATGAAGTAGAACAGATGGTAG -3'
(R):5'- ACCCTAGATGTATGAGCTTGTAAG -3'
Posted On2015-03-18