Incidental Mutation 'R3699:Whrn'
ID 269909
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Name whirlin
Synonyms 1110035G07Rik, wi, Ush2d, Dfnb31, C430046P22Rik
MMRRC Submission 040692-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3699 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 63333147-63414228 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 63379649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000063672] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294] [ENSMUST00000133425]
AlphaFold Q80VW5
Predicted Effect probably benign
Transcript: ENSMUST00000063650
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063672
SMART Domains Protein: ENSMUSP00000065838
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084510
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095038
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102867
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107393
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119294
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140720
Predicted Effect probably benign
Transcript: ENSMUST00000133425
SMART Domains Protein: ENSMUSP00000119280
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDZ 1 65 6.42e-13 SMART
internal_repeat_1 139 164 3.88e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000144965
SMART Domains Protein: ENSMUSP00000121944
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDB:1UF1|A 16 74 7e-33 PDB
SCOP:d1lcya1 32 74 1e-7 SMART
Blast:PDZ 40 74 5e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153307
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,387,757 (GRCm39) A275V possibly damaging Het
Atp1b2 G A 11: 69,496,095 (GRCm39) T35I probably benign Het
Baz1a A G 12: 54,963,831 (GRCm39) V751A probably benign Het
Cdh23 C A 10: 60,163,149 (GRCm39) probably null Het
Chd2 G T 7: 73,118,238 (GRCm39) L1127I probably benign Het
D7Ertd443e A G 7: 133,950,797 (GRCm39) L292P probably damaging Het
Dst T C 1: 34,252,155 (GRCm39) probably benign Het
Dync2i1 C T 12: 116,175,462 (GRCm39) W905* probably null Het
Gm8229 T A 14: 44,603,984 (GRCm39) S58T unknown Het
Gucy2c A T 6: 136,747,109 (GRCm39) C117S probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klhl18 A G 9: 110,265,134 (GRCm39) Y291H probably benign Het
Lamc1 G T 1: 153,130,951 (GRCm39) S333R possibly damaging Het
Lbr T C 1: 181,646,485 (GRCm39) Y479C probably damaging Het
Nampt T C 12: 32,898,758 (GRCm39) probably benign Het
Or10am5 A G 7: 6,517,993 (GRCm39) M145T probably damaging Het
Pcnx3 G T 19: 5,722,493 (GRCm39) R1400S probably damaging Het
Pde4b C T 4: 102,458,742 (GRCm39) A466V probably damaging Het
Piezo1 C T 8: 123,221,642 (GRCm39) R584H probably damaging Het
Polq C A 16: 36,862,518 (GRCm39) S338Y probably damaging Het
Pramel26 A G 4: 143,536,922 (GRCm39) S470P probably benign Het
Rassf8 T C 6: 145,765,802 (GRCm39) probably benign Het
Rere A T 4: 150,561,819 (GRCm39) probably null Het
Rps6kb1 A G 11: 86,423,620 (GRCm39) F120S probably damaging Het
Scarf1 G T 11: 75,405,195 (GRCm39) C78F probably damaging Het
Tepsin C T 11: 119,982,579 (GRCm39) C491Y possibly damaging Het
Trpv4 A G 5: 114,772,861 (GRCm39) S243P probably damaging Het
Zfp521 G T 18: 13,979,330 (GRCm39) S361* probably null Het
Zfyve19 A G 2: 119,041,720 (GRCm39) T96A probably benign Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63,391,015 (GRCm39) missense probably damaging 1.00
IGL01643:Whrn APN 4 63,334,672 (GRCm39) missense possibly damaging 0.79
IGL02065:Whrn APN 4 63,336,822 (GRCm39) missense possibly damaging 0.52
IGL02119:Whrn APN 4 63,353,724 (GRCm39) missense probably damaging 0.99
IGL02589:Whrn APN 4 63,336,334 (GRCm39) nonsense probably null
IGL02638:Whrn APN 4 63,337,709 (GRCm39) missense possibly damaging 0.47
IGL02865:Whrn APN 4 63,333,729 (GRCm39) missense probably benign 0.08
IGL02934:Whrn APN 4 63,334,342 (GRCm39) missense probably damaging 1.00
IGL03372:Whrn APN 4 63,336,855 (GRCm39) missense probably damaging 0.96
R0090:Whrn UTSW 4 63,350,969 (GRCm39) missense possibly damaging 0.79
R0592:Whrn UTSW 4 63,333,804 (GRCm39) missense probably damaging 1.00
R0631:Whrn UTSW 4 63,337,726 (GRCm39) missense probably damaging 1.00
R1916:Whrn UTSW 4 63,412,969 (GRCm39) missense probably damaging 1.00
R1933:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R1958:Whrn UTSW 4 63,353,666 (GRCm39) missense possibly damaging 0.62
R2255:Whrn UTSW 4 63,336,385 (GRCm39) missense possibly damaging 0.92
R2513:Whrn UTSW 4 63,353,649 (GRCm39) missense probably benign 0.22
R3919:Whrn UTSW 4 63,413,421 (GRCm39) nonsense probably null
R4016:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R4241:Whrn UTSW 4 63,351,210 (GRCm39) unclassified probably benign
R4517:Whrn UTSW 4 63,379,517 (GRCm39) critical splice donor site probably null
R4739:Whrn UTSW 4 63,336,402 (GRCm39) missense probably damaging 1.00
R5207:Whrn UTSW 4 63,350,951 (GRCm39) missense probably damaging 1.00
R5281:Whrn UTSW 4 63,336,664 (GRCm39) missense probably benign 0.04
R5307:Whrn UTSW 4 63,350,080 (GRCm39) missense probably benign 0.01
R5463:Whrn UTSW 4 63,351,053 (GRCm39) missense probably benign 0.08
R5663:Whrn UTSW 4 63,336,685 (GRCm39) missense probably damaging 0.98
R5754:Whrn UTSW 4 63,334,825 (GRCm39) missense probably damaging 0.98
R5933:Whrn UTSW 4 63,412,945 (GRCm39) missense probably damaging 1.00
R6212:Whrn UTSW 4 63,412,923 (GRCm39) nonsense probably null
R6380:Whrn UTSW 4 63,336,829 (GRCm39) missense possibly damaging 0.90
R6381:Whrn UTSW 4 63,390,921 (GRCm39) missense probably benign 0.00
R7030:Whrn UTSW 4 63,413,368 (GRCm39) unclassified probably benign
R7350:Whrn UTSW 4 63,350,196 (GRCm39) missense possibly damaging 0.71
R7382:Whrn UTSW 4 63,336,573 (GRCm39) missense probably benign
R7419:Whrn UTSW 4 63,334,330 (GRCm39) missense possibly damaging 0.94
R8334:Whrn UTSW 4 63,413,047 (GRCm39) missense probably damaging 1.00
R9378:Whrn UTSW 4 63,350,079 (GRCm39) missense probably benign 0.00
X0009:Whrn UTSW 4 63,350,148 (GRCm39) missense probably benign 0.00
Z1176:Whrn UTSW 4 63,333,803 (GRCm39) missense probably damaging 1.00
Z1177:Whrn UTSW 4 63,336,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACCACCTGCTTTGCTGAAG -3'
(R):5'- CCTGCCTTTGTGTGGTGAAC -3'

Sequencing Primer
(F):5'- ACCACCTGCTTTGCTGAAGTAAATC -3'
(R):5'- CTTTGTGTGGTGAACAGAGGGAC -3'
Posted On 2015-03-18