Incidental Mutation 'R3699:Gm13084'
ID269912
Institutional Source Beutler Lab
Gene Symbol Gm13084
Ensembl Gene ENSMUSG00000059218
Gene Namepredicted gene 13084
Synonyms
MMRRC Submission 040692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3699 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143809245-143816093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143810352 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 470 (S470P)
Ref Sequence ENSEMBL: ENSMUSP00000074557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075045] [ENSMUST00000105769]
Predicted Effect probably benign
Transcript: ENSMUST00000075045
AA Change: S470P

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074557
Gene: ENSMUSG00000059218
AA Change: S470P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 409 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105769
SMART Domains Protein: ENSMUSP00000101395
Gene: ENSMUSG00000059218

DomainStartEndE-ValueType
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137635
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Atp1b2 G A 11: 69,605,269 T35I probably benign Het
Baz1a A G 12: 54,917,046 V751A probably benign Het
Cdh23 C A 10: 60,327,370 probably null Het
Chd2 G T 7: 73,468,490 L1127I probably benign Het
D7Ertd443e A G 7: 134,349,068 L292P probably damaging Het
Dst T C 1: 34,213,074 probably benign Het
Gm8229 T A 14: 44,366,527 S58T unknown Het
Gucy2c A T 6: 136,770,111 C117S probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A G 9: 110,436,066 Y291H probably benign Het
Lamc1 G T 1: 153,255,205 S333R possibly damaging Het
Lbr T C 1: 181,818,920 Y479C probably damaging Het
Nampt T C 12: 32,848,759 probably benign Het
Olfr1349 A G 7: 6,514,994 M145T probably damaging Het
Pcnx3 G T 19: 5,672,465 R1400S probably damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Piezo1 C T 8: 122,494,903 R584H probably damaging Het
Polq C A 16: 37,042,156 S338Y probably damaging Het
Rassf8 T C 6: 145,820,076 probably benign Het
Rere A T 4: 150,477,362 probably null Het
Rps6kb1 A G 11: 86,532,794 F120S probably damaging Het
Scarf1 G T 11: 75,514,369 C78F probably damaging Het
Tepsin C T 11: 120,091,753 C491Y possibly damaging Het
Trpv4 A G 5: 114,634,800 S243P probably damaging Het
Wdr60 C T 12: 116,211,842 W905* probably null Het
Whrn A T 4: 63,461,412 probably benign Het
Zfp521 G T 18: 13,846,273 S361* probably null Het
Zfyve19 A G 2: 119,211,239 T96A probably benign Het
Other mutations in Gm13084
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Gm13084 APN 4 143812723 missense probably benign 0.32
IGL01075:Gm13084 APN 4 143811646 missense possibly damaging 0.47
IGL02705:Gm13084 APN 4 143810802 missense probably damaging 1.00
IGL03011:Gm13084 APN 4 143811760 missense possibly damaging 0.95
PIT4498001:Gm13084 UTSW 4 143812836 missense possibly damaging 0.63
R0268:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0344:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0390:Gm13084 UTSW 4 143811699 missense probably benign 0.09
R0597:Gm13084 UTSW 4 143812652 missense probably damaging 0.98
R0646:Gm13084 UTSW 4 143812585 missense possibly damaging 0.83
R0927:Gm13084 UTSW 4 143812808 missense probably benign 0.05
R0973:Gm13084 UTSW 4 143811858 missense probably damaging 1.00
R1851:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R1852:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R3705:Gm13084 UTSW 4 143811775 missense probably benign 0.06
R3845:Gm13084 UTSW 4 143811975 missense probably damaging 0.96
R4035:Gm13084 UTSW 4 143810456 missense probably benign 0.08
R4044:Gm13084 UTSW 4 143811600 missense probably benign 0.34
R4439:Gm13084 UTSW 4 143811573 missense possibly damaging 0.49
R4660:Gm13084 UTSW 4 143811865 missense probably benign 0.19
R4770:Gm13084 UTSW 4 143811949 missense probably damaging 0.96
R4838:Gm13084 UTSW 4 143810805 nonsense probably null
R5534:Gm13084 UTSW 4 143812599 nonsense probably null
R5691:Gm13084 UTSW 4 143812009 missense probably benign 0.44
R5893:Gm13084 UTSW 4 143810468 missense probably damaging 1.00
R6123:Gm13084 UTSW 4 143812764 missense possibly damaging 0.89
R6285:Gm13084 UTSW 4 143816039 missense probably damaging 1.00
R6886:Gm13084 UTSW 4 143812762 missense probably benign 0.29
R7105:Gm13084 UTSW 4 143810771 missense probably benign 0.04
R7135:Gm13084 UTSW 4 143810663 missense probably damaging 1.00
R7474:Gm13084 UTSW 4 143811699 missense probably benign 0.03
R7594:Gm13084 UTSW 4 143812716 missense probably damaging 0.99
R7610:Gm13084 UTSW 4 143812866 missense probably damaging 1.00
R7635:Gm13084 UTSW 4 143810417 missense probably damaging 1.00
R7682:Gm13084 UTSW 4 143810720 missense probably benign 0.38
Z1177:Gm13084 UTSW 4 143812018 missense not run
Predicted Primers PCR Primer
(F):5'- TCAGTGTGTCTCAGACATTTAGG -3'
(R):5'- CTGCCTGCCCTAAGTCAATG -3'

Sequencing Primer
(F):5'- GTCTCAGACATTTAGGTGGTTGACAC -3'
(R):5'- GTCAATGTTACCAGCTCACAGTAG -3'
Posted On2015-03-18