Mutagenetix > Incidental Mutations

Incidental Mutation 'R3699:Rassf8'

269917

Institutional Source

Beutler Lab

Gene Symbol

Rassf8

Ensembl Gene

ENSMUSG00000030259

Gene Name

Ras association (RalGDS/AF-6) domain family (N-terminal) member 8

Synonyms

5133400D11Rik, mHoj-1

MMRRC Submission

040692-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.774) question?

Stock #

R3699 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

145746748-145821079 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 145820076 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122684 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]

Predicted Effect

probably benign
Transcript: ENSMUST00000032388

SMART Domains

Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000058538
AA Change: V44A

Predicted Effect

probably benign
Transcript: ENSMUST00000111704

SMART Domains

Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140966

SMART Domains

Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	80	7.85e-7	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd29	G	A	18: 12,254,700	A275V	possibly damaging	Het
Atp1b2	G	A	11: 69,605,269	T35I	probably benign	Het
Baz1a	A	G	12: 54,917,046	V751A	probably benign	Het
Cdh23	C	A	10: 60,327,370		probably null	Het
Chd2	G	T	7: 73,468,490	L1127I	probably benign	Het
D7Ertd443e	A	G	7: 134,349,068	L292P	probably damaging	Het
Dst	T	C	1: 34,213,074		probably benign	Het
Gm13084	A	G	4: 143,810,352	S470P	probably benign	Het
Gm8229	T	A	14: 44,366,527	S58T	unknown	Het
Gucy2c	A	T	6: 136,770,111	C117S	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klhl18	A	G	9: 110,436,066	Y291H	probably benign	Het
Lamc1	G	T	1: 153,255,205	S333R	possibly damaging	Het
Lbr	T	C	1: 181,818,920	Y479C	probably damaging	Het
Nampt	T	C	12: 32,848,759		probably benign	Het
Olfr1349	A	G	7: 6,514,994	M145T	probably damaging	Het
Pcnx3	G	T	19: 5,672,465	R1400S	probably damaging	Het
Pde4b	C	T	4: 102,601,545	A466V	probably damaging	Het
Piezo1	C	T	8: 122,494,903	R584H	probably damaging	Het
Polq	C	A	16: 37,042,156	S338Y	probably damaging	Het
Rere	A	T	4: 150,477,362		probably null	Het
Rps6kb1	A	G	11: 86,532,794	F120S	probably damaging	Het
Scarf1	G	T	11: 75,514,369	C78F	probably damaging	Het
Tepsin	C	T	11: 120,091,753	C491Y	possibly damaging	Het
Trpv4	A	G	5: 114,634,800	S243P	probably damaging	Het
Wdr60	C	T	12: 116,211,842	W905*	probably null	Het
Whrn	A	T	4: 63,461,412		probably benign	Het
Zfp521	G	T	18: 13,846,273	S361*	probably null	Het
Zfyve19	A	G	2: 119,211,239	T96A	probably benign	Het

Other mutations in Rassf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02973:Rassf8	APN	6	145817190	unclassified	probably benign
IGL03017:Rassf8	APN	6	145817198	splice site	probably null
IGL03091:Rassf8	APN	6	145815810	missense	probably benign	0.00
R0230:Rassf8	UTSW	6	145819974	unclassified	probably benign
R0967:Rassf8	UTSW	6	145819950	unclassified	probably benign
R1429:Rassf8	UTSW	6	145815190	missense	probably damaging	1.00
R1622:Rassf8	UTSW	6	145820103	unclassified	probably benign
R1738:Rassf8	UTSW	6	145815308	missense	probably benign	0.03
R1894:Rassf8	UTSW	6	145808473	missense	probably damaging	1.00
R2126:Rassf8	UTSW	6	145815182	missense	probably benign	0.00
R2238:Rassf8	UTSW	6	145817184	missense	probably damaging	1.00
R2439:Rassf8	UTSW	6	145815334	missense	probably damaging	1.00
R4678:Rassf8	UTSW	6	145815082	missense	probably damaging	1.00
R4734:Rassf8	UTSW	6	145815540	missense	probably benign	0.34
R4826:Rassf8	UTSW	6	145816550	missense	probably damaging	1.00
R4910:Rassf8	UTSW	6	145815280	nonsense	probably null
R4988:Rassf8	UTSW	6	145817144	missense	possibly damaging	0.89
R5425:Rassf8	UTSW	6	145815542	missense	probably benign
R5620:Rassf8	UTSW	6	145820181	unclassified	probably benign
R5747:Rassf8	UTSW	6	145815815	missense	probably benign	0.00
R6136:Rassf8	UTSW	6	145815656	missense	probably benign	0.00
R6220:Rassf8	UTSW	6	145817133	missense	probably damaging	1.00
R7274:Rassf8	UTSW	6	145815569	missense	probably benign	0.03
R7315:Rassf8	UTSW	6	145815751	missense	probably benign
R7480:Rassf8	UTSW	6	145820031	missense	unknown
R7593:Rassf8	UTSW	6	145815403	missense	probably benign	0.08
R7714:Rassf8	UTSW	6	145815247	missense	probably damaging	0.98
R7962:Rassf8	UTSW	6	145815943	critical splice donor site	probably null
R8222:Rassf8	UTSW	6	145820057	missense	unknown
R8374:Rassf8	UTSW	6	145815137	nonsense	probably null
R8409:Rassf8	UTSW	6	145815703	missense	probably benign
Z1088:Rassf8	UTSW	6	145815482	missense	probably benign
Z1088:Rassf8	UTSW	6	145816616	missense	probably benign	0.41
Z1176:Rassf8	UTSW	6	145816642	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGTGGGTTACCTCACTTTG -3'
(R):5'- CAATCTATCAAGGTCCTTACTTGC -3'

Sequencing Primer
(F):5'- CTTTACATTTTGGCTGTTAGTGTTCC -3'
(R):5'- GCAAAGATGTTCCCAGATGTTGCTC -3'

Posted On

2015-03-18