Incidental Mutation 'R3699:Rassf8'
ID269917
Institutional Source Beutler Lab
Gene Symbol Rassf8
Ensembl Gene ENSMUSG00000030259
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 8
Synonyms5133400D11Rik, mHoj-1
MMRRC Submission 040692-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R3699 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location145746748-145821079 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 145820076 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]
Predicted Effect probably benign
Transcript: ENSMUST00000032388
SMART Domains Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000058538
AA Change: V44A
Predicted Effect probably benign
Transcript: ENSMUST00000111704
SMART Domains Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140966
SMART Domains Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 80 7.85e-7 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Atp1b2 G A 11: 69,605,269 T35I probably benign Het
Baz1a A G 12: 54,917,046 V751A probably benign Het
Cdh23 C A 10: 60,327,370 probably null Het
Chd2 G T 7: 73,468,490 L1127I probably benign Het
D7Ertd443e A G 7: 134,349,068 L292P probably damaging Het
Dst T C 1: 34,213,074 probably benign Het
Gm13084 A G 4: 143,810,352 S470P probably benign Het
Gm8229 T A 14: 44,366,527 S58T unknown Het
Gucy2c A T 6: 136,770,111 C117S probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A G 9: 110,436,066 Y291H probably benign Het
Lamc1 G T 1: 153,255,205 S333R possibly damaging Het
Lbr T C 1: 181,818,920 Y479C probably damaging Het
Nampt T C 12: 32,848,759 probably benign Het
Olfr1349 A G 7: 6,514,994 M145T probably damaging Het
Pcnx3 G T 19: 5,672,465 R1400S probably damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Piezo1 C T 8: 122,494,903 R584H probably damaging Het
Polq C A 16: 37,042,156 S338Y probably damaging Het
Rere A T 4: 150,477,362 probably null Het
Rps6kb1 A G 11: 86,532,794 F120S probably damaging Het
Scarf1 G T 11: 75,514,369 C78F probably damaging Het
Tepsin C T 11: 120,091,753 C491Y possibly damaging Het
Trpv4 A G 5: 114,634,800 S243P probably damaging Het
Wdr60 C T 12: 116,211,842 W905* probably null Het
Whrn A T 4: 63,461,412 probably benign Het
Zfp521 G T 18: 13,846,273 S361* probably null Het
Zfyve19 A G 2: 119,211,239 T96A probably benign Het
Other mutations in Rassf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02973:Rassf8 APN 6 145817190 unclassified probably benign
IGL03017:Rassf8 APN 6 145817198 splice site probably null
IGL03091:Rassf8 APN 6 145815810 missense probably benign 0.00
R0230:Rassf8 UTSW 6 145819974 unclassified probably benign
R0967:Rassf8 UTSW 6 145819950 unclassified probably benign
R1429:Rassf8 UTSW 6 145815190 missense probably damaging 1.00
R1622:Rassf8 UTSW 6 145820103 unclassified probably benign
R1738:Rassf8 UTSW 6 145815308 missense probably benign 0.03
R1894:Rassf8 UTSW 6 145808473 missense probably damaging 1.00
R2126:Rassf8 UTSW 6 145815182 missense probably benign 0.00
R2238:Rassf8 UTSW 6 145817184 missense probably damaging 1.00
R2439:Rassf8 UTSW 6 145815334 missense probably damaging 1.00
R4678:Rassf8 UTSW 6 145815082 missense probably damaging 1.00
R4734:Rassf8 UTSW 6 145815540 missense probably benign 0.34
R4826:Rassf8 UTSW 6 145816550 missense probably damaging 1.00
R4910:Rassf8 UTSW 6 145815280 nonsense probably null
R4988:Rassf8 UTSW 6 145817144 missense possibly damaging 0.89
R5425:Rassf8 UTSW 6 145815542 missense probably benign
R5620:Rassf8 UTSW 6 145820181 unclassified probably benign
R5747:Rassf8 UTSW 6 145815815 missense probably benign 0.00
R6136:Rassf8 UTSW 6 145815656 missense probably benign 0.00
R6220:Rassf8 UTSW 6 145817133 missense probably damaging 1.00
R7274:Rassf8 UTSW 6 145815569 missense probably benign 0.03
R7315:Rassf8 UTSW 6 145815751 missense probably benign
R7480:Rassf8 UTSW 6 145820031 missense unknown
R7593:Rassf8 UTSW 6 145815403 missense probably benign 0.08
R7714:Rassf8 UTSW 6 145815247 missense probably damaging 0.98
R7962:Rassf8 UTSW 6 145815943 critical splice donor site probably null
R8222:Rassf8 UTSW 6 145820057 missense unknown
R8374:Rassf8 UTSW 6 145815137 nonsense probably null
R8409:Rassf8 UTSW 6 145815703 missense probably benign
Z1088:Rassf8 UTSW 6 145815482 missense probably benign
Z1088:Rassf8 UTSW 6 145816616 missense probably benign 0.41
Z1176:Rassf8 UTSW 6 145816642 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGTGGGTTACCTCACTTTG -3'
(R):5'- CAATCTATCAAGGTCCTTACTTGC -3'

Sequencing Primer
(F):5'- CTTTACATTTTGGCTGTTAGTGTTCC -3'
(R):5'- GCAAAGATGTTCCCAGATGTTGCTC -3'
Posted On2015-03-18