Incidental Mutation 'R3699:Ankrd29'
ID269933
Institutional Source Beutler Lab
Gene Symbol Ankrd29
Ensembl Gene ENSMUSG00000057766
Gene Nameankyrin repeat domain 29
Synonyms
MMRRC Submission 040692-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R3699 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12252362-12305720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12254700 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 275 (A275V)
Ref Sequence ENSEMBL: ENSMUSP00000114028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118525] [ENSMUST00000122408]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118525
AA Change: A275V

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114028
Gene: ENSMUSG00000057766
AA Change: A275V

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
ANK 242 271 3.01e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122408
AA Change: A242V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112888
Gene: ENSMUSG00000057766
AA Change: A242V

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137948
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1b2 G A 11: 69,605,269 T35I probably benign Het
Baz1a A G 12: 54,917,046 V751A probably benign Het
Cdh23 C A 10: 60,327,370 probably null Het
Chd2 G T 7: 73,468,490 L1127I probably benign Het
D7Ertd443e A G 7: 134,349,068 L292P probably damaging Het
Dst T C 1: 34,213,074 probably benign Het
Gm13084 A G 4: 143,810,352 S470P probably benign Het
Gm8229 T A 14: 44,366,527 S58T unknown Het
Gucy2c A T 6: 136,770,111 C117S probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A G 9: 110,436,066 Y291H probably benign Het
Lamc1 G T 1: 153,255,205 S333R possibly damaging Het
Lbr T C 1: 181,818,920 Y479C probably damaging Het
Nampt T C 12: 32,848,759 probably benign Het
Olfr1349 A G 7: 6,514,994 M145T probably damaging Het
Pcnx3 G T 19: 5,672,465 R1400S probably damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Piezo1 C T 8: 122,494,903 R584H probably damaging Het
Polq C A 16: 37,042,156 S338Y probably damaging Het
Rassf8 T C 6: 145,820,076 probably benign Het
Rere A T 4: 150,477,362 probably null Het
Rps6kb1 A G 11: 86,532,794 F120S probably damaging Het
Scarf1 G T 11: 75,514,369 C78F probably damaging Het
Tepsin C T 11: 120,091,753 C491Y possibly damaging Het
Trpv4 A G 5: 114,634,800 S243P probably damaging Het
Wdr60 C T 12: 116,211,842 W905* probably null Het
Whrn A T 4: 63,461,412 probably benign Het
Zfp521 G T 18: 13,846,273 S361* probably null Het
Zfyve19 A G 2: 119,211,239 T96A probably benign Het
Other mutations in Ankrd29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Ankrd29 APN 18 12275738 missense probably benign 0.00
IGL02956:Ankrd29 APN 18 12260936 missense probably damaging 1.00
R0456:Ankrd29 UTSW 18 12295979 missense probably damaging 1.00
R2879:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3693:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3694:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3700:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4130:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4132:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4745:Ankrd29 UTSW 18 12254622 missense probably benign 0.00
R4989:Ankrd29 UTSW 18 12262185 missense probably damaging 1.00
R5531:Ankrd29 UTSW 18 12279778 missense probably damaging 1.00
R5985:Ankrd29 UTSW 18 12279775 missense probably damaging 1.00
R6187:Ankrd29 UTSW 18 12279690 nonsense probably null
R6627:Ankrd29 UTSW 18 12262164 missense probably benign 0.02
R6895:Ankrd29 UTSW 18 12260989 missense probably benign 0.36
R7671:Ankrd29 UTSW 18 12260986 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TATAGGGCAGTGTGAGAAGCCC -3'
(R):5'- GAACAGCGGGTACTACTTCTC -3'

Sequencing Primer
(F):5'- CCACAGGGCAGACATTCTTTC -3'
(R):5'- GAACAGCGGGTACTACTTCTCATTAG -3'
Posted On2015-03-18