Incidental Mutation 'R3700:Tasp1'
ID269939
Institutional Source Beutler Lab
Gene Symbol Tasp1
Ensembl Gene ENSMUSG00000039033
Gene Nametaspase, threonine aspartase 1
Synonyms
MMRRC Submission 040693-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R3700 (G1)
Quality Score145
Status Validated
Chromosome2
Chromosomal Location139833480-140066805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139910554 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 322 (T322A)
Ref Sequence ENSEMBL: ENSMUSP00000105706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046656] [ENSMUST00000099304] [ENSMUST00000110079]
Predicted Effect probably benign
Transcript: ENSMUST00000046656
AA Change: T322A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039546
Gene: ENSMUSG00000039033
AA Change: T322A

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 346 1.1e-50 PFAM
low complexity region 347 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099304
SMART Domains Protein: ENSMUSP00000096907
Gene: ENSMUSG00000039033

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 286 1.1e-46 PFAM
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110079
AA Change: T322A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105706
Gene: ENSMUSG00000039033
AA Change: T322A

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 348 1.3e-62 PFAM
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endopeptidase that cleaves specific substrates following aspartate residues. The encoded protein undergoes posttranslational autoproteolytic processing to generate alpha and beta subunits, which reassemble into the active alpha2-beta2 heterotetramer. It is required to cleave MLL, a protein required for the maintenance of HOX gene expression, and TFIIA, a basal transcription factor. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display prenatal and early postnatal lethality, reduced body size, impaired suckling behavior, homeotic transformations of the axial skeleton, and cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 G A 18: 65,305,151 T1524I probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arhgap26 T A 18: 39,120,184 F221L probably damaging Het
Arhgap28 T C 17: 67,901,366 S36G probably damaging Het
Bcl11a A G 11: 24,163,890 D411G probably damaging Het
Cdh23 C A 10: 60,327,370 probably null Het
Cnnm2 T A 19: 46,762,551 I260N probably damaging Het
Coro6 T C 11: 77,467,303 F238S probably damaging Het
Ddah1 G A 3: 145,891,495 M162I probably benign Het
Dnah5 T C 15: 28,387,791 I3132T possibly damaging Het
Eif3f A T 7: 108,940,275 I251F probably benign Het
Ephx4 T C 5: 107,402,807 F11L probably benign Het
Esp1 T C 17: 40,731,107 S97P unknown Het
Fbxw10 A T 11: 62,869,157 probably null Het
Hsp90ab1 T C 17: 45,571,514 T85A possibly damaging Het
Idh2 T C 7: 80,099,147 K129E probably damaging Het
Kcnj6 A G 16: 94,833,006 I64T probably damaging Het
Klk5 T A 7: 43,850,827 C280S probably damaging Het
Lhx2 T A 2: 38,360,099 L269H probably damaging Het
Lrrc71 T A 3: 87,745,878 probably null Het
Lss T A 10: 76,546,192 L484Q probably damaging Het
Mmp14 G A 14: 54,431,932 probably benign Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Mysm1 T C 4: 94,970,652 K87E probably benign Het
Olfr213 T A 6: 116,540,528 V25E probably benign Het
Olfr523 C G 7: 140,176,214 F37L possibly damaging Het
Pcolce T C 5: 137,609,047 T61A probably damaging Het
Phc3 C A 3: 30,914,128 D920Y probably damaging Het
Pi4kb T C 3: 94,994,288 I422T probably benign Het
Piezo1 C T 8: 122,494,903 R584H probably damaging Het
Plce1 T A 19: 38,705,337 F768Y probably damaging Het
Ppp1r21 T C 17: 88,582,454 S709P possibly damaging Het
Prdx6 T C 1: 161,247,288 D74G probably damaging Het
Prrxl1 A T 14: 32,628,861 E218V probably damaging Het
Rlf A G 4: 121,150,863 F307L possibly damaging Het
Skiv2l T C 17: 34,849,903 E40G probably benign Het
Snapin G A 3: 90,490,192 R91* probably null Het
Sort1 T A 3: 108,356,639 L838* probably null Het
Sstr4 A G 2: 148,396,353 I295V possibly damaging Het
Stk39 T A 2: 68,392,118 I201F probably damaging Het
Tepsin C T 11: 120,091,753 C491Y possibly damaging Het
Tlr9 G A 9: 106,224,079 V190M probably damaging Het
Ttf2 A G 3: 100,951,008 L755P probably damaging Het
Txn2 G A 15: 77,927,776 T60M possibly damaging Het
Vmn1r10 A G 6: 57,114,302 N293S probably benign Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r111 C T 17: 22,571,161 W288* probably null Het
Vmn2r118 T C 17: 55,608,421 S510G possibly damaging Het
Wdr60 C T 12: 116,211,842 W905* probably null Het
Zgpat T A 2: 181,365,646 probably benign Het
Zzef1 G T 11: 72,886,772 G1810C probably null Het
Other mutations in Tasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Tasp1 APN 2 139977618 missense probably damaging 1.00
IGL01476:Tasp1 APN 2 140008773 missense probably benign 0.01
IGL02876:Tasp1 APN 2 139834363 missense probably benign 0.45
PIT4449001:Tasp1 UTSW 2 139910535 missense possibly damaging 0.67
R0352:Tasp1 UTSW 2 139951458 critical splice donor site probably null
R0381:Tasp1 UTSW 2 139951483 missense probably damaging 1.00
R1056:Tasp1 UTSW 2 140008764 missense possibly damaging 0.94
R1350:Tasp1 UTSW 2 140057421 missense probably damaging 1.00
R1836:Tasp1 UTSW 2 139951557 missense probably damaging 1.00
R2005:Tasp1 UTSW 2 139977678 missense probably damaging 1.00
R2129:Tasp1 UTSW 2 140048244 missense possibly damaging 0.75
R2259:Tasp1 UTSW 2 139951506 missense probably damaging 1.00
R2321:Tasp1 UTSW 2 140057412 missense probably benign 0.05
R3842:Tasp1 UTSW 2 139951501 missense probably damaging 1.00
R5526:Tasp1 UTSW 2 140008789 missense probably damaging 1.00
R5724:Tasp1 UTSW 2 140057419 missense probably damaging 0.99
R6345:Tasp1 UTSW 2 139951537 missense probably damaging 1.00
R6533:Tasp1 UTSW 2 139834357 makesense probably null
R7723:Tasp1 UTSW 2 139985131 missense probably damaging 1.00
R7796:Tasp1 UTSW 2 140008785 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTCTCAGAATCTAGACACTAAAG -3'
(R):5'- TCCTGCAACGGAACTACTTG -3'

Sequencing Primer
(F):5'- GAATTGCTGATATCATGCTGTAGTAG -3'
(R):5'- TACTTGTAAGTAGTGCACAAGGG -3'
Posted On2015-03-18