Incidental Mutation 'R3700:Sstr4'
ID269940
Institutional Source Beutler Lab
Gene Symbol Sstr4
Ensembl Gene ENSMUSG00000037014
Gene Namesomatostatin receptor 4
SynonymsSmstr4, sst4
MMRRC Submission 040693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R3700 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location148395344-148396767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148396353 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 295 (I295V)
Ref Sequence ENSEMBL: ENSMUSP00000105588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109962]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109962
AA Change: I295V

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105588
Gene: ENSMUSG00000037014
AA Change: I295V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 55 323 4.7e-16 PFAM
Pfam:7tm_1 61 308 2.2e-61 PFAM
Pfam:7TM_GPCR_Srv 117 325 1.8e-10 PFAM
Pfam:7TM_GPCR_Srw 203 326 8.1e-9 PFAM
Meta Mutation Damage Score 0.1219 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have increased susceptibility to inflammation, delayed type hypersensitivity, hyperalgesia and airway hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 G A 18: 65,305,151 T1524I probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arhgap26 T A 18: 39,120,184 F221L probably damaging Het
Arhgap28 T C 17: 67,901,366 S36G probably damaging Het
Bcl11a A G 11: 24,163,890 D411G probably damaging Het
Cdh23 C A 10: 60,327,370 probably null Het
Cnnm2 T A 19: 46,762,551 I260N probably damaging Het
Coro6 T C 11: 77,467,303 F238S probably damaging Het
Ddah1 G A 3: 145,891,495 M162I probably benign Het
Dnah5 T C 15: 28,387,791 I3132T possibly damaging Het
Eif3f A T 7: 108,940,275 I251F probably benign Het
Ephx4 T C 5: 107,402,807 F11L probably benign Het
Esp1 T C 17: 40,731,107 S97P unknown Het
Fbxw10 A T 11: 62,869,157 probably null Het
Hsp90ab1 T C 17: 45,571,514 T85A possibly damaging Het
Idh2 T C 7: 80,099,147 K129E probably damaging Het
Kcnj6 A G 16: 94,833,006 I64T probably damaging Het
Klk5 T A 7: 43,850,827 C280S probably damaging Het
Lhx2 T A 2: 38,360,099 L269H probably damaging Het
Lrrc71 T A 3: 87,745,878 probably null Het
Lss T A 10: 76,546,192 L484Q probably damaging Het
Mmp14 G A 14: 54,431,932 probably benign Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Mysm1 T C 4: 94,970,652 K87E probably benign Het
Olfr213 T A 6: 116,540,528 V25E probably benign Het
Olfr523 C G 7: 140,176,214 F37L possibly damaging Het
Pcolce T C 5: 137,609,047 T61A probably damaging Het
Phc3 C A 3: 30,914,128 D920Y probably damaging Het
Pi4kb T C 3: 94,994,288 I422T probably benign Het
Piezo1 C T 8: 122,494,903 R584H probably damaging Het
Plce1 T A 19: 38,705,337 F768Y probably damaging Het
Ppp1r21 T C 17: 88,582,454 S709P possibly damaging Het
Prdx6 T C 1: 161,247,288 D74G probably damaging Het
Prrxl1 A T 14: 32,628,861 E218V probably damaging Het
Rlf A G 4: 121,150,863 F307L possibly damaging Het
Skiv2l T C 17: 34,849,903 E40G probably benign Het
Snapin G A 3: 90,490,192 R91* probably null Het
Sort1 T A 3: 108,356,639 L838* probably null Het
Stk39 T A 2: 68,392,118 I201F probably damaging Het
Tasp1 T C 2: 139,910,554 T322A probably benign Het
Tepsin C T 11: 120,091,753 C491Y possibly damaging Het
Tlr9 G A 9: 106,224,079 V190M probably damaging Het
Ttf2 A G 3: 100,951,008 L755P probably damaging Het
Txn2 G A 15: 77,927,776 T60M possibly damaging Het
Vmn1r10 A G 6: 57,114,302 N293S probably benign Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r111 C T 17: 22,571,161 W288* probably null Het
Vmn2r118 T C 17: 55,608,421 S510G possibly damaging Het
Wdr60 C T 12: 116,211,842 W905* probably null Het
Zgpat T A 2: 181,365,646 probably benign Het
Zzef1 G T 11: 72,886,772 G1810C probably null Het
Other mutations in Sstr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Sstr4 APN 2 148395552 missense probably benign 0.00
IGL01536:Sstr4 APN 2 148395880 missense probably damaging 1.00
IGL02210:Sstr4 APN 2 148396309 missense probably damaging 1.00
IGL02670:Sstr4 APN 2 148396533 nonsense probably null
R0396:Sstr4 UTSW 2 148396261 missense probably damaging 1.00
R1428:Sstr4 UTSW 2 148396359 missense probably benign 0.01
R1839:Sstr4 UTSW 2 148395533 missense probably benign 0.21
R2332:Sstr4 UTSW 2 148396410 missense probably damaging 1.00
R2943:Sstr4 UTSW 2 148396165 missense probably damaging 0.96
R5502:Sstr4 UTSW 2 148395551 small insertion probably benign
R5503:Sstr4 UTSW 2 148395551 small insertion probably benign
R5596:Sstr4 UTSW 2 148395732 missense possibly damaging 0.65
R5726:Sstr4 UTSW 2 148396083 missense probably damaging 1.00
R6985:Sstr4 UTSW 2 148396249 missense probably damaging 0.97
X0022:Sstr4 UTSW 2 148395532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGCTTATTGTGGGCAAGATG -3'
(R):5'- CAGAGGAGGGCATATGCATC -3'

Sequencing Primer
(F):5'- GCAAGATGCGCGCTGTG -3'
(R):5'- GCATCCTGCACCCCCTCTG -3'
Posted On2015-03-18