Incidental Mutation 'R3700:Ddah1'
ID269947
Institutional Source Beutler Lab
Gene Symbol Ddah1
Ensembl Gene ENSMUSG00000028194
Gene Namedimethylarginine dimethylaminohydrolase 1
Synonyms2410006N07Rik, 2510015N06Rik
MMRRC Submission 040693-MU
Accession Numbers

NCBI RefSeq: NM_026993.3; MGI: 1916469

Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R3700 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location145758675-145894277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145891495 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 162 (M162I)
Ref Sequence ENSEMBL: ENSMUSP00000112747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029845] [ENSMUST00000120310]
Predicted Effect probably benign
Transcript: ENSMUST00000029845
AA Change: M265I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029845
Gene: ENSMUSG00000028194
AA Change: M265I

DomainStartEndE-ValueType
Pfam:Amidinotransf 12 279 9.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120310
AA Change: M162I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112747
Gene: ENSMUSG00000028194
AA Change: M162I

DomainStartEndE-ValueType
Pfam:Amidinotransf 1 178 2.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127193
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (51/52)
MGI Phenotype Strain: 3711768; 5424370
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both heterozygous and homozygous inactivation of this gene leads to increased plasma asymmetrical dimethylarginine (ADMA) levels, reduced cardiovascular nitric oxide production, and increased blood pressure. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(4) Gene trapped(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 G A 18: 65,305,151 T1524I probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arhgap26 T A 18: 39,120,184 F221L probably damaging Het
Arhgap28 T C 17: 67,901,366 S36G probably damaging Het
Bcl11a A G 11: 24,163,890 D411G probably damaging Het
Cdh23 C A 10: 60,327,370 probably null Het
Cnnm2 T A 19: 46,762,551 I260N probably damaging Het
Coro6 T C 11: 77,467,303 F238S probably damaging Het
Dnah5 T C 15: 28,387,791 I3132T possibly damaging Het
Eif3f A T 7: 108,940,275 I251F probably benign Het
Ephx4 T C 5: 107,402,807 F11L probably benign Het
Esp1 T C 17: 40,731,107 S97P unknown Het
Fbxw10 A T 11: 62,869,157 probably null Het
Hsp90ab1 T C 17: 45,571,514 T85A possibly damaging Het
Idh2 T C 7: 80,099,147 K129E probably damaging Het
Kcnj6 A G 16: 94,833,006 I64T probably damaging Het
Klk5 T A 7: 43,850,827 C280S probably damaging Het
Lhx2 T A 2: 38,360,099 L269H probably damaging Het
Lrrc71 T A 3: 87,745,878 probably null Het
Lss T A 10: 76,546,192 L484Q probably damaging Het
Mmp14 G A 14: 54,431,932 probably benign Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Mysm1 T C 4: 94,970,652 K87E probably benign Het
Olfr213 T A 6: 116,540,528 V25E probably benign Het
Olfr523 C G 7: 140,176,214 F37L possibly damaging Het
Pcolce T C 5: 137,609,047 T61A probably damaging Het
Phc3 C A 3: 30,914,128 D920Y probably damaging Het
Pi4kb T C 3: 94,994,288 I422T probably benign Het
Piezo1 C T 8: 122,494,903 R584H probably damaging Het
Plce1 T A 19: 38,705,337 F768Y probably damaging Het
Ppp1r21 T C 17: 88,582,454 S709P possibly damaging Het
Prdx6 T C 1: 161,247,288 D74G probably damaging Het
Prrxl1 A T 14: 32,628,861 E218V probably damaging Het
Rlf A G 4: 121,150,863 F307L possibly damaging Het
Skiv2l T C 17: 34,849,903 E40G probably benign Het
Snapin G A 3: 90,490,192 R91* probably null Het
Sort1 T A 3: 108,356,639 L838* probably null Het
Sstr4 A G 2: 148,396,353 I295V possibly damaging Het
Stk39 T A 2: 68,392,118 I201F probably damaging Het
Tasp1 T C 2: 139,910,554 T322A probably benign Het
Tepsin C T 11: 120,091,753 C491Y possibly damaging Het
Tlr9 G A 9: 106,224,079 V190M probably damaging Het
Ttf2 A G 3: 100,951,008 L755P probably damaging Het
Txn2 G A 15: 77,927,776 T60M possibly damaging Het
Vmn1r10 A G 6: 57,114,302 N293S probably benign Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r111 C T 17: 22,571,161 W288* probably null Het
Vmn2r118 T C 17: 55,608,421 S510G possibly damaging Het
Wdr60 C T 12: 116,211,842 W905* probably null Het
Zgpat T A 2: 181,365,646 probably benign Het
Zzef1 G T 11: 72,886,772 G1810C probably null Het
Other mutations in Ddah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02947:Ddah1 APN 3 145759087 missense probably benign 0.44
P0014:Ddah1 UTSW 3 145853158 missense probably benign 0.36
R1386:Ddah1 UTSW 3 145889211 missense probably benign 0.00
R1455:Ddah1 UTSW 3 145889109 missense probably benign 0.29
R1464:Ddah1 UTSW 3 145853274 nonsense probably null
R1464:Ddah1 UTSW 3 145853274 nonsense probably null
R1557:Ddah1 UTSW 3 145891472 missense probably benign 0.00
R1724:Ddah1 UTSW 3 145891506 missense probably damaging 0.99
R1853:Ddah1 UTSW 3 145891549 missense probably benign
R6170:Ddah1 UTSW 3 145891506 missense probably benign 0.06
R7603:Ddah1 UTSW 3 145759019 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CAAGGGGTCAAGCACATGTG -3'
(R):5'- TTAGTAGCACAGTGGCCCAG -3'

Sequencing Primer
(F):5'- TCAAGCACATGTGGCCAG -3'
(R):5'- ACAGTGGCCCAGTAGATTGTC -3'
Posted On2015-03-18