Incidental Mutation 'R3700:Olfr523'
ID269958
Institutional Source Beutler Lab
Gene Symbol Olfr523
Ensembl Gene ENSMUSG00000051051
Gene Nameolfactory receptor 523
SynonymsMOR104-4, GA_x6K02T2PBJ9-42327937-42328872
MMRRC Submission 040693-MU
Accession Numbers

Genbank: NM_146518; MGI: 3030357

Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R3700 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140173217-140178758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 140176214 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 37 (F37L)
Ref Sequence ENSEMBL: ENSMUSP00000052678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055890] [ENSMUST00000209314] [ENSMUST00000213953] [ENSMUST00000214272] [ENSMUST00000215785] [ENSMUST00000216023]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055890
AA Change: F37L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052678
Gene: ENSMUSG00000051051
AA Change: F37L

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_4 40 317 1.6e-50 PFAM
Pfam:7tm_1 50 299 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209314
AA Change: F31L

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000213953
AA Change: F31L

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000214272
AA Change: F31L

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215785
AA Change: F31L

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216023
AA Change: F31L

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 G A 18: 65,305,151 T1524I probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arhgap26 T A 18: 39,120,184 F221L probably damaging Het
Arhgap28 T C 17: 67,901,366 S36G probably damaging Het
Bcl11a A G 11: 24,163,890 D411G probably damaging Het
Cdh23 C A 10: 60,327,370 probably null Het
Cnnm2 T A 19: 46,762,551 I260N probably damaging Het
Coro6 T C 11: 77,467,303 F238S probably damaging Het
Ddah1 G A 3: 145,891,495 M162I probably benign Het
Dnah5 T C 15: 28,387,791 I3132T possibly damaging Het
Eif3f A T 7: 108,940,275 I251F probably benign Het
Ephx4 T C 5: 107,402,807 F11L probably benign Het
Esp1 T C 17: 40,731,107 S97P unknown Het
Fbxw10 A T 11: 62,869,157 probably null Het
Hsp90ab1 T C 17: 45,571,514 T85A possibly damaging Het
Idh2 T C 7: 80,099,147 K129E probably damaging Het
Kcnj6 A G 16: 94,833,006 I64T probably damaging Het
Klk5 T A 7: 43,850,827 C280S probably damaging Het
Lhx2 T A 2: 38,360,099 L269H probably damaging Het
Lrrc71 T A 3: 87,745,878 probably null Het
Lss T A 10: 76,546,192 L484Q probably damaging Het
Mmp14 G A 14: 54,431,932 probably benign Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Mysm1 T C 4: 94,970,652 K87E probably benign Het
Olfr213 T A 6: 116,540,528 V25E probably benign Het
Pcolce T C 5: 137,609,047 T61A probably damaging Het
Phc3 C A 3: 30,914,128 D920Y probably damaging Het
Pi4kb T C 3: 94,994,288 I422T probably benign Het
Piezo1 C T 8: 122,494,903 R584H probably damaging Het
Plce1 T A 19: 38,705,337 F768Y probably damaging Het
Ppp1r21 T C 17: 88,582,454 S709P possibly damaging Het
Prdx6 T C 1: 161,247,288 D74G probably damaging Het
Prrxl1 A T 14: 32,628,861 E218V probably damaging Het
Rlf A G 4: 121,150,863 F307L possibly damaging Het
Skiv2l T C 17: 34,849,903 E40G probably benign Het
Snapin G A 3: 90,490,192 R91* probably null Het
Sort1 T A 3: 108,356,639 L838* probably null Het
Sstr4 A G 2: 148,396,353 I295V possibly damaging Het
Stk39 T A 2: 68,392,118 I201F probably damaging Het
Tasp1 T C 2: 139,910,554 T322A probably benign Het
Tepsin C T 11: 120,091,753 C491Y possibly damaging Het
Tlr9 G A 9: 106,224,079 V190M probably damaging Het
Ttf2 A G 3: 100,951,008 L755P probably damaging Het
Txn2 G A 15: 77,927,776 T60M possibly damaging Het
Vmn1r10 A G 6: 57,114,302 N293S probably benign Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r111 C T 17: 22,571,161 W288* probably null Het
Vmn2r118 T C 17: 55,608,421 S510G possibly damaging Het
Wdr60 C T 12: 116,211,842 W905* probably null Het
Zgpat T A 2: 181,365,646 probably benign Het
Zzef1 G T 11: 72,886,772 G1810C probably null Het
Other mutations in Olfr523
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr523 APN 7 140176615 missense probably damaging 1.00
IGL01759:Olfr523 APN 7 140176534 missense probably benign 0.00
D3080:Olfr523 UTSW 7 140176362 missense possibly damaging 0.94
R0503:Olfr523 UTSW 7 140176441 missense possibly damaging 0.95
R1644:Olfr523 UTSW 7 140176648 missense probably benign 0.12
R1760:Olfr523 UTSW 7 140176275 missense probably damaging 1.00
R1852:Olfr523 UTSW 7 140176561 nonsense probably null
R1960:Olfr523 UTSW 7 140176683 missense probably benign 0.37
R2363:Olfr523 UTSW 7 140176965 missense probably damaging 1.00
R4626:Olfr523 UTSW 7 140176446 missense probably damaging 1.00
R4678:Olfr523 UTSW 7 140176228 missense probably benign 0.21
R4779:Olfr523 UTSW 7 140176450 missense probably damaging 1.00
R4999:Olfr523 UTSW 7 140177020 missense probably damaging 1.00
R5663:Olfr523 UTSW 7 140176321 missense probably damaging 1.00
R7352:Olfr523 UTSW 7 140176525 missense probably damaging 1.00
R8525:Olfr523 UTSW 7 140176342 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTGAGTAGACTCCACGAAG -3'
(R):5'- ACGAAGTACATCTGTGTGGC -3'

Sequencing Primer
(F):5'- TGAGTAGACTCCACGAAGAACAG -3'
(R):5'- CACAGCCAGCCAAGGAGATG -3'
Posted On2015-03-18