Incidental Mutation 'R3700:Vmn1r232'
ID269973
Institutional Source Beutler Lab
Gene Symbol Vmn1r232
Ensembl Gene ENSMUSG00000062165
Gene Namevomeronasal 1 receptor 232
SynonymsV1re4
MMRRC Submission 040693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3700 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20913205-20914363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20914203 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 45 (L45P)
Ref Sequence ENSEMBL: ENSMUSP00000076261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077001]
Predicted Effect probably benign
Transcript: ENSMUST00000077001
AA Change: L45P

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076261
Gene: ENSMUSG00000062165
AA Change: L45P

DomainStartEndE-ValueType
Pfam:TAS2R 46 331 6.9e-7 PFAM
Pfam:7tm_1 70 324 1e-6 PFAM
Pfam:V1R 78 338 1.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232004
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 G A 18: 65,305,151 T1524I probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arhgap26 T A 18: 39,120,184 F221L probably damaging Het
Arhgap28 T C 17: 67,901,366 S36G probably damaging Het
Bcl11a A G 11: 24,163,890 D411G probably damaging Het
Cdh23 C A 10: 60,327,370 probably null Het
Cnnm2 T A 19: 46,762,551 I260N probably damaging Het
Coro6 T C 11: 77,467,303 F238S probably damaging Het
Ddah1 G A 3: 145,891,495 M162I probably benign Het
Dnah5 T C 15: 28,387,791 I3132T possibly damaging Het
Eif3f A T 7: 108,940,275 I251F probably benign Het
Ephx4 T C 5: 107,402,807 F11L probably benign Het
Esp1 T C 17: 40,731,107 S97P unknown Het
Fbxw10 A T 11: 62,869,157 probably null Het
Hsp90ab1 T C 17: 45,571,514 T85A possibly damaging Het
Idh2 T C 7: 80,099,147 K129E probably damaging Het
Kcnj6 A G 16: 94,833,006 I64T probably damaging Het
Klk5 T A 7: 43,850,827 C280S probably damaging Het
Lhx2 T A 2: 38,360,099 L269H probably damaging Het
Lrrc71 T A 3: 87,745,878 probably null Het
Lss T A 10: 76,546,192 L484Q probably damaging Het
Mmp14 G A 14: 54,431,932 probably benign Het
Muc5b A G 7: 141,847,249 T534A unknown Het
Mysm1 T C 4: 94,970,652 K87E probably benign Het
Olfr213 T A 6: 116,540,528 V25E probably benign Het
Olfr523 C G 7: 140,176,214 F37L possibly damaging Het
Pcolce T C 5: 137,609,047 T61A probably damaging Het
Phc3 C A 3: 30,914,128 D920Y probably damaging Het
Pi4kb T C 3: 94,994,288 I422T probably benign Het
Piezo1 C T 8: 122,494,903 R584H probably damaging Het
Plce1 T A 19: 38,705,337 F768Y probably damaging Het
Ppp1r21 T C 17: 88,582,454 S709P possibly damaging Het
Prdx6 T C 1: 161,247,288 D74G probably damaging Het
Prrxl1 A T 14: 32,628,861 E218V probably damaging Het
Rlf A G 4: 121,150,863 F307L possibly damaging Het
Skiv2l T C 17: 34,849,903 E40G probably benign Het
Snapin G A 3: 90,490,192 R91* probably null Het
Sort1 T A 3: 108,356,639 L838* probably null Het
Sstr4 A G 2: 148,396,353 I295V possibly damaging Het
Stk39 T A 2: 68,392,118 I201F probably damaging Het
Tasp1 T C 2: 139,910,554 T322A probably benign Het
Tepsin C T 11: 120,091,753 C491Y possibly damaging Het
Tlr9 G A 9: 106,224,079 V190M probably damaging Het
Ttf2 A G 3: 100,951,008 L755P probably damaging Het
Txn2 G A 15: 77,927,776 T60M possibly damaging Het
Vmn1r10 A G 6: 57,114,302 N293S probably benign Het
Vmn2r111 C T 17: 22,571,161 W288* probably null Het
Vmn2r118 T C 17: 55,608,421 S510G possibly damaging Het
Wdr60 C T 12: 116,211,842 W905* probably null Het
Zgpat T A 2: 181,365,646 probably benign Het
Zzef1 G T 11: 72,886,772 G1810C probably null Het
Other mutations in Vmn1r232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Vmn1r232 APN 17 20914132 missense probably benign 0.07
IGL02576:Vmn1r232 APN 17 20913913 missense probably benign 0.30
H8562:Vmn1r232 UTSW 17 20913394 missense probably benign 0.29
R1182:Vmn1r232 UTSW 17 20913443 missense possibly damaging 0.95
R2010:Vmn1r232 UTSW 17 20913339 missense probably benign 0.00
R2088:Vmn1r232 UTSW 17 20913737 missense possibly damaging 0.63
R2206:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2207:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2273:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2274:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2275:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2443:Vmn1r232 UTSW 17 20913384 missense probably damaging 1.00
R2516:Vmn1r232 UTSW 17 20914026 missense possibly damaging 0.65
R5256:Vmn1r232 UTSW 17 20913584 missense probably damaging 1.00
R5418:Vmn1r232 UTSW 17 20914116 missense possibly damaging 0.75
R5726:Vmn1r232 UTSW 17 20913339 missense probably benign 0.00
R5833:Vmn1r232 UTSW 17 20913651 missense probably damaging 1.00
R6528:Vmn1r232 UTSW 17 20914047 missense probably benign 0.12
R7019:Vmn1r232 UTSW 17 20913285 missense possibly damaging 0.76
R7600:Vmn1r232 UTSW 17 20913737 missense possibly damaging 0.63
R8377:Vmn1r232 UTSW 17 20913977 missense probably benign 0.00
Z1088:Vmn1r232 UTSW 17 20913838 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TCAAGGAGTTAGATGTGAGCAC -3'
(R):5'- CCATCGCGTTTCACAGGATG -3'

Sequencing Primer
(F):5'- GTGAGCACATGTACTAGAATCATGTC -3'
(R):5'- GTTTCACAGGATGGAACCCC -3'
Posted On2015-03-18