Incidental Mutation 'R3734:Cyp2a4'
ID270000
Institutional Source Beutler Lab
Gene Symbol Cyp2a4
Ensembl Gene ENSMUSG00000074254
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 4
SynonymsD7Ucla4, Cyp15a1, testosterone 15alpha-hydroxylase
MMRRC Submission 040721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3734 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26307169-26315088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26312827 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 345 (D345G)
Ref Sequence ENSEMBL: ENSMUSP00000096254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098657]
Predicted Effect probably damaging
Transcript: ENSMUST00000098657
AA Change: D345G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096254
Gene: ENSMUSG00000074254
AA Change: D345G

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 8.9e-151 PFAM
Meta Mutation Damage Score 0.8548 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Ablim1 A T 19: 57,049,460 probably null Het
Blvra A T 2: 127,090,255 probably benign Het
Ccdc87 G T 19: 4,841,923 W814C probably damaging Het
Dsg2 T C 18: 20,601,947 V994A probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Eps8l2 A C 7: 141,357,821 Y418S probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Fcgr3 T C 1: 171,057,874 M60V probably benign Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Golga1 G T 2: 39,050,170 Q141K possibly damaging Het
Ift122 A G 6: 115,925,501 probably benign Het
Iqcg G T 16: 33,053,626 probably benign Het
Itga1 T C 13: 114,977,639 H910R probably benign Het
Jak3 C A 8: 71,676,581 probably benign Het
Jrkl A G 9: 13,245,530 V42A possibly damaging Het
Kif2c T C 4: 117,162,646 S515G probably benign Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lsamp T C 16: 42,144,770 I330T probably benign Het
Map3k6 T C 4: 133,248,396 S732P possibly damaging Het
Muc5b C T 7: 141,859,037 Q1907* probably null Het
Nap1l4 A C 7: 143,534,395 probably null Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Nol4 A T 18: 22,770,864 probably benign Het
Olfr168 T A 16: 19,530,648 I91F probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pbld2 T C 10: 63,071,465 L161P probably damaging Het
Pcdha6 T A 18: 36,969,401 V549E probably damaging Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Scmh1 T A 4: 120,478,080 I154N probably damaging Het
Skor1 A T 9: 63,140,068 L879Q probably damaging Het
Slc1a7 G C 4: 107,977,644 R69P probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Tenm1 C T X: 42,684,067 V1023M probably benign Het
Tpte G A 8: 22,359,482 C575Y probably damaging Het
Ulk4 T C 9: 121,261,989 K216E probably benign Het
Unc5d T C 8: 28,761,798 I216V probably benign Het
Vmn2r16 T C 5: 109,330,414 S12P probably benign Het
Other mutations in Cyp2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Cyp2a4 APN 7 26308544 missense probably damaging 1.00
IGL01609:Cyp2a4 APN 7 26308663 critical splice donor site probably null
IGL01959:Cyp2a4 APN 7 26307708 missense probably damaging 1.00
IGL02282:Cyp2a4 APN 7 26309047 missense probably benign 0.01
IGL03053:Cyp2a4 APN 7 26313550 splice site probably benign
IGL03168:Cyp2a4 APN 7 26313550 splice site probably benign
R0393:Cyp2a4 UTSW 7 26312868 missense possibly damaging 0.67
R0453:Cyp2a4 UTSW 7 26312833 missense probably benign 0.22
R0825:Cyp2a4 UTSW 7 26312916 missense probably benign 0.07
R0948:Cyp2a4 UTSW 7 26310788 missense probably damaging 1.00
R1215:Cyp2a4 UTSW 7 26314801 missense possibly damaging 0.75
R1222:Cyp2a4 UTSW 7 26308588 missense possibly damaging 0.70
R1374:Cyp2a4 UTSW 7 26312923 missense probably damaging 0.99
R1473:Cyp2a4 UTSW 7 26314763 missense probably benign
R1580:Cyp2a4 UTSW 7 26307651 missense possibly damaging 0.91
R1768:Cyp2a4 UTSW 7 26312772 missense possibly damaging 0.94
R1832:Cyp2a4 UTSW 7 26312210 missense probably damaging 0.99
R1911:Cyp2a4 UTSW 7 26308974 missense possibly damaging 0.85
R2080:Cyp2a4 UTSW 7 26308537 missense possibly damaging 0.96
R2086:Cyp2a4 UTSW 7 26312308 missense probably damaging 1.00
R2259:Cyp2a4 UTSW 7 26309035 missense probably damaging 0.99
R2877:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R2878:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3733:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3741:Cyp2a4 UTSW 7 26308544 missense probably damaging 1.00
R4079:Cyp2a4 UTSW 7 26307366 missense probably benign 0.22
R4297:Cyp2a4 UTSW 7 26307368 missense probably damaging 0.96
R4785:Cyp2a4 UTSW 7 26312875 missense probably damaging 1.00
R4998:Cyp2a4 UTSW 7 26307361 missense probably damaging 1.00
R5297:Cyp2a4 UTSW 7 26312204 missense probably benign 0.07
R5893:Cyp2a4 UTSW 7 26308928 missense probably damaging 1.00
R5942:Cyp2a4 UTSW 7 26310704 critical splice acceptor site probably null
R6262:Cyp2a4 UTSW 7 26312230 missense probably damaging 0.99
R6612:Cyp2a4 UTSW 7 26308647 missense probably benign 0.00
R6722:Cyp2a4 UTSW 7 26313558 missense probably benign 0.04
R7064:Cyp2a4 UTSW 7 26312307 missense probably benign 0.02
R7419:Cyp2a4 UTSW 7 26314763 missense probably benign 0.00
R7562:Cyp2a4 UTSW 7 26312896 missense possibly damaging 0.88
R8231:Cyp2a4 UTSW 7 26312937 missense probably benign 0.00
R8750:Cyp2a4 UTSW 7 26312784 missense probably benign 0.00
Z1176:Cyp2a4 UTSW 7 26307323 nonsense probably null
Z1176:Cyp2a4 UTSW 7 26310841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAAGCAGTTTCACCAATGC -3'
(R):5'- TGGACTCTGAGGAGAAGGTC -3'

Sequencing Primer
(F):5'- GCAGTTTCACCAATGCATGATTTG -3'
(R):5'- AAGGTCCTAGAGGCCCATG -3'
Posted On2015-03-18