Incidental Mutation 'R3734:Nap1l4'
ID270003
Institutional Source Beutler Lab
Gene Symbol Nap1l4
Ensembl Gene ENSMUSG00000059119
Gene Namenucleosome assembly protein 1-like 4
SynonymsNap2, D7Wsu30e, 2810410H14Rik
MMRRC Submission 040721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R3734 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143513579-143549106 bp(-) (GRCm38)
Type of Mutationsplice site (1592 bp from exon)
DNA Base Change (assembly) A to C at 143534395 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072727] [ENSMUST00000207870] [ENSMUST00000207948] [ENSMUST00000208093] [ENSMUST00000208190] [ENSMUST00000209098]
Predicted Effect probably benign
Transcript: ENSMUST00000072727
AA Change: V142G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000072510
Gene: ENSMUSG00000059119
AA Change: V142G

DomainStartEndE-ValueType
Pfam:NAP 65 338 5e-103 PFAM
low complexity region 341 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207244
Predicted Effect probably null
Transcript: ENSMUST00000207870
Predicted Effect probably benign
Transcript: ENSMUST00000207948
Predicted Effect probably null
Transcript: ENSMUST00000208093
Predicted Effect probably benign
Transcript: ENSMUST00000208190
AA Change: V142G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000208317
Predicted Effect probably benign
Transcript: ENSMUST00000209098
AA Change: V142G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1381 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family which can interact with both core and linker histones. It can shuttle between the cytoplasm and nucleus, suggesting a role as a histone chaperone. This gene is one of several located near the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Blvra A T 2: 127,090,255 probably benign Het
Ccdc87 G T 19: 4,841,923 W814C probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Dsg2 T C 18: 20,601,947 V994A probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Eps8l2 A C 7: 141,357,821 Y418S probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Fcgr3 T C 1: 171,057,874 M60V probably benign Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Golga1 G T 2: 39,050,170 Q141K possibly damaging Het
Ift122 A G 6: 115,925,501 probably benign Het
Iqcg G T 16: 33,053,626 probably benign Het
Itga1 T C 13: 114,977,639 H910R probably benign Het
Jak3 C A 8: 71,676,581 probably benign Het
Jrkl A G 9: 13,245,530 V42A possibly damaging Het
Kif2c T C 4: 117,162,646 S515G probably benign Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lsamp T C 16: 42,144,770 I330T probably benign Het
Map3k6 T C 4: 133,248,396 S732P possibly damaging Het
Muc5b C T 7: 141,859,037 Q1907* probably null Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Nol4 A T 18: 22,770,864 probably benign Het
Olfr168 T A 16: 19,530,648 I91F probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pbld2 T C 10: 63,071,465 L161P probably damaging Het
Pcdha6 T A 18: 36,969,401 V549E probably damaging Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Scmh1 T A 4: 120,478,080 I154N probably damaging Het
Skor1 A T 9: 63,140,068 L879Q probably damaging Het
Slc1a7 G C 4: 107,977,644 R69P probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Tenm1 C T X: 42,684,067 V1023M probably benign Het
Tpte G A 8: 22,359,482 C575Y probably damaging Het
Ulk4 T C 9: 121,261,989 K216E probably benign Het
Unc5d T C 8: 28,761,798 I216V probably benign Het
Vmn2r16 T C 5: 109,330,414 S12P probably benign Het
Other mutations in Nap1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Nap1l4 APN 7 143527316 splice site probably null
IGL02696:Nap1l4 APN 7 143524161 missense possibly damaging 0.67
IGL02710:Nap1l4 APN 7 143524261 missense probably benign 0.00
IGL03059:Nap1l4 APN 7 143527165 critical splice donor site probably null
IGL03164:Nap1l4 APN 7 143538216 critical splice donor site probably null
IGL03240:Nap1l4 APN 7 143538245 missense probably benign 0.00
Ballerina UTSW 7 143534463 splice site probably null
R1576:Nap1l4 UTSW 7 143538216 critical splice donor site probably null
R1705:Nap1l4 UTSW 7 143541760 start codon destroyed probably null 1.00
R1967:Nap1l4 UTSW 7 143534287 missense probably damaging 0.99
R1989:Nap1l4 UTSW 7 143527184 missense probably damaging 0.99
R4799:Nap1l4 UTSW 7 143534463 splice site probably null
R5367:Nap1l4 UTSW 7 143534298 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACAAGAATCGGGCATCACC -3'
(R):5'- GCAGAACTTGGTTGAAGCTGTG -3'

Sequencing Primer
(F):5'- GGCATCACCCCAGTCTCC -3'
(R):5'- TGTTCCTAATGATCCAAGAAAAGCC -3'
Posted On2015-03-18