Incidental Mutation 'R3735:Shroom3'
ID270057
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Nameshroom family member 3
SynonymsD5Ertd287e, Shrm3, Shrm
MMRRC Submission 040722-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3735 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92683435-92965318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92964444 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1888 (V1888A)
Ref Sequence ENSEMBL: ENSMUSP00000108678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000225438]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113051
AA Change: V1713A

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1713A

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113054
AA Change: V1713A

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1713A

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113055
AA Change: V1888A

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1888A

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1757A
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1757A

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172752
Predicted Effect possibly damaging
Transcript: ENSMUST00000225438
AA Change: V1807A

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1575 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4921539E11Rik C G 4: 103,266,406 E90Q probably damaging Het
Acadl G A 1: 66,853,289 A125V probably benign Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adam17 T C 12: 21,325,412 D802G probably benign Het
Aoc3 A T 11: 101,332,219 D427V probably damaging Het
Bivm C T 1: 44,126,434 H15Y probably benign Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Cdca7 T A 2: 72,483,865 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Champ1 T C 8: 13,878,735 S298P probably damaging Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dcaf10 C T 4: 45,348,117 T191I probably benign Het
Dido1 A G 2: 180,684,036 probably benign Het
Dnah7b C T 1: 46,299,875 T3361I probably benign Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Eml5 G A 12: 98,855,989 T721I possibly damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Fam169b G T 7: 68,350,301 R198S probably damaging Het
Gm7694 A G 1: 170,302,761 S23P probably damaging Het
Grk3 T A 5: 112,953,831 T248S probably benign Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Ido2 C T 8: 24,535,193 V273M probably damaging Het
Il12rb1 T C 8: 70,817,218 L518P probably damaging Het
Kansl1l A G 1: 66,801,250 V297A possibly damaging Het
Kcnj10 A G 1: 172,369,966 Y349C possibly damaging Het
Krt18 A G 15: 102,028,501 T75A probably benign Het
Lrmp G A 6: 145,160,870 probably benign Het
Lrp4 A T 2: 91,498,371 I1539F probably damaging Het
Map3k6 T C 4: 133,246,372 V458A probably benign Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Med13 A C 11: 86,279,658 M1850R probably benign Het
Mfsd13a A G 19: 46,368,328 Y256C probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Myo9b T C 8: 71,348,597 V1133A probably benign Het
Myom2 A T 8: 15,069,676 H144L probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nkx1-1 C T 5: 33,433,730 V83I unknown Het
Npy4r T A 14: 34,147,269 T21S probably benign Het
Nup88 A G 11: 70,956,192 S331P probably damaging Het
Olfr1294 T A 2: 111,537,896 H131L probably damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Otogl A T 10: 107,899,529 Y131* probably null Het
Pgr G A 9: 8,901,533 G356S probably damaging Het
Prdm2 T C 4: 143,134,359 E787G probably damaging Het
Prpf18 A G 2: 4,643,673 I114T probably benign Het
R3hdm2 T A 10: 127,465,010 I280N probably benign Het
Rims4 T C 2: 163,863,985 D243G possibly damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Rpap2 T C 5: 107,655,151 probably benign Het
Sdr16c5 G A 4: 4,005,614 T240I probably benign Het
Slc36a4 T A 9: 15,738,273 Y466* probably null Het
Slco3a1 A G 7: 74,504,497 I80T probably damaging Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Stam A T 2: 14,129,012 Q190L probably damaging Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tacstd2 A G 6: 67,534,859 V283A probably damaging Het
Tln1 G T 4: 43,549,370 A616E probably damaging Het
Trdmt1 A T 2: 13,519,873 F257Y possibly damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trps1 A G 15: 50,846,060 I298T possibly damaging Het
Tti2 T C 8: 31,155,897 L413P probably damaging Het
Utrn A G 10: 12,478,484 V343A probably damaging Het
Vwf G T 6: 125,588,613 W288L probably damaging Het
Zfp629 T A 7: 127,612,778 probably benign Het
Zfp873 G A 10: 82,061,181 S582N probably benign Het
Zfp979 A G 4: 147,613,482 Y257H possibly damaging Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 92951065 missense probably damaging 1.00
IGL01086:Shroom3 APN 5 92948452 missense probably benign 0.01
IGL01363:Shroom3 APN 5 92940993 missense probably benign 0.01
IGL01468:Shroom3 APN 5 92940342 missense probably damaging 1.00
IGL01675:Shroom3 APN 5 92941680 missense probably damaging 0.99
IGL01862:Shroom3 APN 5 92962289 missense probably damaging 1.00
IGL01987:Shroom3 APN 5 92942189 missense probably damaging 0.99
IGL02104:Shroom3 APN 5 92940389 missense probably benign 0.32
IGL03248:Shroom3 APN 5 92952540 missense probably benign 0.00
IGL03386:Shroom3 APN 5 92948483 splice site probably benign
R0167:Shroom3 UTSW 5 92948395 splice site probably benign
R0388:Shroom3 UTSW 5 92951293 missense probably benign 0.39
R0395:Shroom3 UTSW 5 92780903 missense probably damaging 1.00
R0567:Shroom3 UTSW 5 92964453 missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 92942834 missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 92940656 missense probably damaging 0.97
R1845:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R1921:Shroom3 UTSW 5 92962365 critical splice donor site probably null
R2059:Shroom3 UTSW 5 92683784 missense probably damaging 1.00
R2203:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2301:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2344:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2345:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2346:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2348:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92780870 missense probably damaging 1.00
R2435:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2829:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2830:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2831:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2897:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2898:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3080:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3433:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3729:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3730:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3736:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3852:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3943:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3969:Shroom3 UTSW 5 92940879 missense probably benign 0.05
R4008:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4009:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4012:Shroom3 UTSW 5 92948483 splice site probably benign
R4154:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4157:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4172:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4173:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4201:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4202:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4206:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4284:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4285:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4364:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4384:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4456:Shroom3 UTSW 5 92940999 missense probably benign 0.14
R4707:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4712:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4751:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4755:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4760:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4773:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4774:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4776:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4801:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4802:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4856:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4857:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4882:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4883:Shroom3 UTSW 5 92951134 missense probably benign 0.14
R4886:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R5262:Shroom3 UTSW 5 92964573 missense probably damaging 1.00
R5271:Shroom3 UTSW 5 92962248 missense probably damaging 1.00
R5719:Shroom3 UTSW 5 92943018 missense probably benign 0.04
R5726:Shroom3 UTSW 5 92943005 missense probably benign 0.00
R5993:Shroom3 UTSW 5 92940188 missense probably damaging 1.00
R6078:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6138:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6153:Shroom3 UTSW 5 92964408 missense probably damaging 0.99
R6493:Shroom3 UTSW 5 92941561 missense probably benign 0.03
R6495:Shroom3 UTSW 5 92942069 missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 92940758 missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 92940936 missense probably damaging 1.00
R6893:Shroom3 UTSW 5 92942204 missense probably damaging 0.97
R6912:Shroom3 UTSW 5 92943017 missense probably benign 0.02
R6924:Shroom3 UTSW 5 92964403 missense probably damaging 1.00
R7083:Shroom3 UTSW 5 92964525 missense probably damaging 1.00
R7197:Shroom3 UTSW 5 92942604 missense probably damaging 1.00
R7366:Shroom3 UTSW 5 92964606 nonsense probably null
R7712:Shroom3 UTSW 5 92950947 missense probably benign 0.01
R7725:Shroom3 UTSW 5 92941653 missense probably benign 0.19
R7728:Shroom3 UTSW 5 92683707 missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 92950489 missense probably damaging 0.98
R7795:Shroom3 UTSW 5 92919649 missense probably damaging 0.99
R7821:Shroom3 UTSW 5 92940846 missense probably damaging 0.98
R7971:Shroom3 UTSW 5 92951074 missense probably damaging 1.00
R8276:Shroom3 UTSW 5 92940480 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGAGCACTGGTTTGCAGCC -3'
(R):5'- GTCAACGTTGGGAAAACACC -3'

Sequencing Primer
(F):5'- CACTGGTTTGCAGCCCTGTG -3'
(R):5'- GTTGGGAAAACACCACCGAATACAG -3'
Posted On2015-03-18