Incidental Mutation 'R3735:Myom2'
ID270071
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Namemyomesin 2
Synonyms
MMRRC Submission 040722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R3735 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location15057653-15133541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15069676 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 144 (H144L)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
Predicted Effect probably benign
Transcript: ENSMUST00000033842
AA Change: H144L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: H144L

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131251
Meta Mutation Damage Score 0.1266 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4921539E11Rik C G 4: 103,266,406 E90Q probably damaging Het
Acadl G A 1: 66,853,289 A125V probably benign Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adam17 T C 12: 21,325,412 D802G probably benign Het
Aoc3 A T 11: 101,332,219 D427V probably damaging Het
Bivm C T 1: 44,126,434 H15Y probably benign Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Cdca7 T A 2: 72,483,865 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Champ1 T C 8: 13,878,735 S298P probably damaging Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dcaf10 C T 4: 45,348,117 T191I probably benign Het
Dido1 A G 2: 180,684,036 probably benign Het
Dnah7b C T 1: 46,299,875 T3361I probably benign Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Eml5 G A 12: 98,855,989 T721I possibly damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Fam169b G T 7: 68,350,301 R198S probably damaging Het
Gm7694 A G 1: 170,302,761 S23P probably damaging Het
Grk3 T A 5: 112,953,831 T248S probably benign Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Ido2 C T 8: 24,535,193 V273M probably damaging Het
Il12rb1 T C 8: 70,817,218 L518P probably damaging Het
Kansl1l A G 1: 66,801,250 V297A possibly damaging Het
Kcnj10 A G 1: 172,369,966 Y349C possibly damaging Het
Krt18 A G 15: 102,028,501 T75A probably benign Het
Lrmp G A 6: 145,160,870 probably benign Het
Lrp4 A T 2: 91,498,371 I1539F probably damaging Het
Map3k6 T C 4: 133,246,372 V458A probably benign Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Med13 A C 11: 86,279,658 M1850R probably benign Het
Mfsd13a A G 19: 46,368,328 Y256C probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Myo9b T C 8: 71,348,597 V1133A probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nkx1-1 C T 5: 33,433,730 V83I unknown Het
Npy4r T A 14: 34,147,269 T21S probably benign Het
Nup88 A G 11: 70,956,192 S331P probably damaging Het
Olfr1294 T A 2: 111,537,896 H131L probably damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Otogl A T 10: 107,899,529 Y131* probably null Het
Pgr G A 9: 8,901,533 G356S probably damaging Het
Prdm2 T C 4: 143,134,359 E787G probably damaging Het
Prpf18 A G 2: 4,643,673 I114T probably benign Het
R3hdm2 T A 10: 127,465,010 I280N probably benign Het
Rims4 T C 2: 163,863,985 D243G possibly damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Rpap2 T C 5: 107,655,151 probably benign Het
Sdr16c5 G A 4: 4,005,614 T240I probably benign Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Slc36a4 T A 9: 15,738,273 Y466* probably null Het
Slco3a1 A G 7: 74,504,497 I80T probably damaging Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Stam A T 2: 14,129,012 Q190L probably damaging Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tacstd2 A G 6: 67,534,859 V283A probably damaging Het
Tln1 G T 4: 43,549,370 A616E probably damaging Het
Trdmt1 A T 2: 13,519,873 F257Y possibly damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trps1 A G 15: 50,846,060 I298T possibly damaging Het
Tti2 T C 8: 31,155,897 L413P probably damaging Het
Utrn A G 10: 12,478,484 V343A probably damaging Het
Vwf G T 6: 125,588,613 W288L probably damaging Het
Zfp629 T A 7: 127,612,778 probably benign Het
Zfp873 G A 10: 82,061,181 S582N probably benign Het
Zfp979 A G 4: 147,613,482 Y257H possibly damaging Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 intron probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7690:Myom2 UTSW 8 15111717 critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15083259 missense probably damaging 1.00
R7822:Myom2 UTSW 8 15108454 missense probably benign
RF001:Myom2 UTSW 8 15081418 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGCTAGACAAGTACTTCATGGAGC -3'
(R):5'- TTGCATAGGCCTAGACGACAG -3'

Sequencing Primer
(F):5'- TACTTCATGGAGCAGACGGTAG -3'
(R):5'- GCCTAGACGACAGGCTCAAAG -3'
Posted On2015-03-18