Incidental Mutation 'R3735:Aoc3'
ID270086
Institutional Source Beutler Lab
Gene Symbol Aoc3
Ensembl Gene ENSMUSG00000019326
Gene Nameamine oxidase, copper containing 3
Synonymssemicarbazide-sensitive amine oxidase, SSAO, VAP1
MMRRC Submission 040722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R3735 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101330605-101341938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101332219 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 427 (D427V)
Ref Sequence ENSEMBL: ENSMUSP00000099394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017316] [ENSMUST00000041095] [ENSMUST00000103105] [ENSMUST00000107264]
Predicted Effect probably benign
Transcript: ENSMUST00000017316
SMART Domains Protein: ENSMUSP00000017316
Gene: ENSMUSG00000019326

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 23 109 4.3e-24 PFAM
Pfam:Cu_amine_oxidN3 126 226 1.4e-28 PFAM
Pfam:Cu_amine_oxid 251 444 4.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041095
SMART Domains Protein: ENSMUSP00000040255
Gene: ENSMUSG00000078651

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 165 263 5.7e-22 PFAM
Pfam:Cu_amine_oxid 309 718 3.7e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103105
AA Change: D427V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099394
Gene: ENSMUSG00000019326
AA Change: D427V

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 169 269 1.5e-31 PFAM
low complexity region 284 298 N/A INTRINSIC
Pfam:Cu_amine_oxid 314 721 5.3e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107264
SMART Domains Protein: ENSMUSP00000102885
Gene: ENSMUSG00000078651

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 8.2e-24 PFAM
Pfam:Cu_amine_oxidN3 165 263 9.9e-20 PFAM
Pfam:Cu_amine_oxid 308 605 5.9e-86 PFAM
Pfam:Cu_amine_oxid 600 694 7.3e-26 PFAM
Meta Mutation Damage Score 0.7661 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice display decreased lymphocyte migration and homing in response to inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4921539E11Rik C G 4: 103,266,406 E90Q probably damaging Het
Acadl G A 1: 66,853,289 A125V probably benign Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adam17 T C 12: 21,325,412 D802G probably benign Het
Bivm C T 1: 44,126,434 H15Y probably benign Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Cdca7 T A 2: 72,483,865 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Champ1 T C 8: 13,878,735 S298P probably damaging Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dcaf10 C T 4: 45,348,117 T191I probably benign Het
Dido1 A G 2: 180,684,036 probably benign Het
Dnah7b C T 1: 46,299,875 T3361I probably benign Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Eml5 G A 12: 98,855,989 T721I possibly damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Fam169b G T 7: 68,350,301 R198S probably damaging Het
Gm7694 A G 1: 170,302,761 S23P probably damaging Het
Grk3 T A 5: 112,953,831 T248S probably benign Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Ido2 C T 8: 24,535,193 V273M probably damaging Het
Il12rb1 T C 8: 70,817,218 L518P probably damaging Het
Kansl1l A G 1: 66,801,250 V297A possibly damaging Het
Kcnj10 A G 1: 172,369,966 Y349C possibly damaging Het
Krt18 A G 15: 102,028,501 T75A probably benign Het
Lrmp G A 6: 145,160,870 probably benign Het
Lrp4 A T 2: 91,498,371 I1539F probably damaging Het
Map3k6 T C 4: 133,246,372 V458A probably benign Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Med13 A C 11: 86,279,658 M1850R probably benign Het
Mfsd13a A G 19: 46,368,328 Y256C probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Myo9b T C 8: 71,348,597 V1133A probably benign Het
Myom2 A T 8: 15,069,676 H144L probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nkx1-1 C T 5: 33,433,730 V83I unknown Het
Npy4r T A 14: 34,147,269 T21S probably benign Het
Nup88 A G 11: 70,956,192 S331P probably damaging Het
Olfr1294 T A 2: 111,537,896 H131L probably damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Otogl A T 10: 107,899,529 Y131* probably null Het
Pgr G A 9: 8,901,533 G356S probably damaging Het
Prdm2 T C 4: 143,134,359 E787G probably damaging Het
Prpf18 A G 2: 4,643,673 I114T probably benign Het
R3hdm2 T A 10: 127,465,010 I280N probably benign Het
Rims4 T C 2: 163,863,985 D243G possibly damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Rpap2 T C 5: 107,655,151 probably benign Het
Sdr16c5 G A 4: 4,005,614 T240I probably benign Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Slc36a4 T A 9: 15,738,273 Y466* probably null Het
Slco3a1 A G 7: 74,504,497 I80T probably damaging Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Stam A T 2: 14,129,012 Q190L probably damaging Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tacstd2 A G 6: 67,534,859 V283A probably damaging Het
Tln1 G T 4: 43,549,370 A616E probably damaging Het
Trdmt1 A T 2: 13,519,873 F257Y possibly damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trps1 A G 15: 50,846,060 I298T possibly damaging Het
Tti2 T C 8: 31,155,897 L413P probably damaging Het
Utrn A G 10: 12,478,484 V343A probably damaging Het
Vwf G T 6: 125,588,613 W288L probably damaging Het
Zfp629 T A 7: 127,612,778 probably benign Het
Zfp873 G A 10: 82,061,181 S582N probably benign Het
Zfp979 A G 4: 147,613,482 Y257H possibly damaging Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Other mutations in Aoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Aoc3 APN 11 101337478 missense possibly damaging 0.73
IGL02026:Aoc3 APN 11 101337595 missense probably benign
IGL02500:Aoc3 APN 11 101337389 nonsense probably null
R0463:Aoc3 UTSW 11 101331606 missense probably damaging 1.00
R0524:Aoc3 UTSW 11 101337511 missense probably damaging 1.00
R0538:Aoc3 UTSW 11 101332138 missense possibly damaging 0.77
R0685:Aoc3 UTSW 11 101336447 missense possibly damaging 0.84
R0740:Aoc3 UTSW 11 101332332 missense probably benign 0.01
R0946:Aoc3 UTSW 11 101332305 missense possibly damaging 0.89
R1723:Aoc3 UTSW 11 101336435 missense possibly damaging 0.82
R1869:Aoc3 UTSW 11 101331467 nonsense probably null
R4497:Aoc3 UTSW 11 101332045 missense possibly damaging 0.70
R4613:Aoc3 UTSW 11 101337659 intron probably benign
R4858:Aoc3 UTSW 11 101331662 missense probably damaging 1.00
R4954:Aoc3 UTSW 11 101332099 missense probably damaging 1.00
R4976:Aoc3 UTSW 11 101330974 missense probably damaging 1.00
R5770:Aoc3 UTSW 11 101331752 nonsense probably null
R6679:Aoc3 UTSW 11 101331453 missense probably damaging 1.00
R7485:Aoc3 UTSW 11 101337403 missense probably damaging 1.00
R7693:Aoc3 UTSW 11 101332512 missense probably benign 0.00
R7888:Aoc3 UTSW 11 101332497 missense probably damaging 1.00
R8041:Aoc3 UTSW 11 101332306 missense probably benign 0.00
R8444:Aoc3 UTSW 11 101341747 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTATGAAATCAGTGTCCAGGAGG -3'
(R):5'- CCTGTGGCGTGGAATTTGAC -3'

Sequencing Primer
(F):5'- TCAGTGTCCAGGAGGCCATAG -3'
(R):5'- GGAATTTGACTTCTATGGCCCCATTG -3'
Posted On2015-03-18