Incidental Mutation 'R3735:Trps1'
ID270094
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Nametranscriptional repressor GATA binding 1
SynonymsD15Ertd586e
MMRRC Submission 040722-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3735 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location50654752-50890463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50846060 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 298 (I298T)
Ref Sequence ENSEMBL: ENSMUSP00000139017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885] [ENSMUST00000185183]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077935
AA Change: I294T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: I294T

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165201
AA Change: I294T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: I294T

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183757
AA Change: I298T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: I298T

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183997
AA Change: I298T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: I298T

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184458
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184885
AA Change: I248T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: I248T

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185183
SMART Domains Protein: ENSMUSP00000138967
Gene: ENSMUSG00000038679

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
Meta Mutation Damage Score 0.2497 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4921539E11Rik C G 4: 103,266,406 E90Q probably damaging Het
Acadl G A 1: 66,853,289 A125V probably benign Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adam17 T C 12: 21,325,412 D802G probably benign Het
Aoc3 A T 11: 101,332,219 D427V probably damaging Het
Bivm C T 1: 44,126,434 H15Y probably benign Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Cdca7 T A 2: 72,483,865 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Champ1 T C 8: 13,878,735 S298P probably damaging Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dcaf10 C T 4: 45,348,117 T191I probably benign Het
Dido1 A G 2: 180,684,036 probably benign Het
Dnah7b C T 1: 46,299,875 T3361I probably benign Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Eml5 G A 12: 98,855,989 T721I possibly damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Fam169b G T 7: 68,350,301 R198S probably damaging Het
Gm7694 A G 1: 170,302,761 S23P probably damaging Het
Grk3 T A 5: 112,953,831 T248S probably benign Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Ido2 C T 8: 24,535,193 V273M probably damaging Het
Il12rb1 T C 8: 70,817,218 L518P probably damaging Het
Kansl1l A G 1: 66,801,250 V297A possibly damaging Het
Kcnj10 A G 1: 172,369,966 Y349C possibly damaging Het
Krt18 A G 15: 102,028,501 T75A probably benign Het
Lrmp G A 6: 145,160,870 probably benign Het
Lrp4 A T 2: 91,498,371 I1539F probably damaging Het
Map3k6 T C 4: 133,246,372 V458A probably benign Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Med13 A C 11: 86,279,658 M1850R probably benign Het
Mfsd13a A G 19: 46,368,328 Y256C probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Myo9b T C 8: 71,348,597 V1133A probably benign Het
Myom2 A T 8: 15,069,676 H144L probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nkx1-1 C T 5: 33,433,730 V83I unknown Het
Npy4r T A 14: 34,147,269 T21S probably benign Het
Nup88 A G 11: 70,956,192 S331P probably damaging Het
Olfr1294 T A 2: 111,537,896 H131L probably damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Otogl A T 10: 107,899,529 Y131* probably null Het
Pgr G A 9: 8,901,533 G356S probably damaging Het
Prdm2 T C 4: 143,134,359 E787G probably damaging Het
Prpf18 A G 2: 4,643,673 I114T probably benign Het
R3hdm2 T A 10: 127,465,010 I280N probably benign Het
Rims4 T C 2: 163,863,985 D243G possibly damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Rpap2 T C 5: 107,655,151 probably benign Het
Sdr16c5 G A 4: 4,005,614 T240I probably benign Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Slc36a4 T A 9: 15,738,273 Y466* probably null Het
Slco3a1 A G 7: 74,504,497 I80T probably damaging Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Stam A T 2: 14,129,012 Q190L probably damaging Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tacstd2 A G 6: 67,534,859 V283A probably damaging Het
Tln1 G T 4: 43,549,370 A616E probably damaging Het
Trdmt1 A T 2: 13,519,873 F257Y possibly damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Tti2 T C 8: 31,155,897 L413P probably damaging Het
Utrn A G 10: 12,478,484 V343A probably damaging Het
Vwf G T 6: 125,588,613 W288L probably damaging Het
Zfp629 T A 7: 127,612,778 probably benign Het
Zfp873 G A 10: 82,061,181 S582N probably benign Het
Zfp979 A G 4: 147,613,482 Y257H possibly damaging Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50846870 missense probably benign 0.07
IGL00497:Trps1 APN 15 50661307 missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50661085 missense probably damaging 1.00
IGL01325:Trps1 APN 15 50846814 missense probably benign 0.40
IGL02132:Trps1 APN 15 50822278 missense probably damaging 1.00
IGL02631:Trps1 APN 15 50846021 missense probably damaging 1.00
IGL02740:Trps1 APN 15 50846539 missense probably damaging 1.00
IGL02821:Trps1 APN 15 50660877 missense probably damaging 1.00
IGL03096:Trps1 APN 15 50846479 missense probably benign
F5770:Trps1 UTSW 15 50831577 missense probably damaging 1.00
R0050:Trps1 UTSW 15 50765525 missense probably benign 0.18
R0244:Trps1 UTSW 15 50664743 missense probably damaging 1.00
R0377:Trps1 UTSW 15 50831778 nonsense probably null
R0599:Trps1 UTSW 15 50831860 nonsense probably null
R0848:Trps1 UTSW 15 50661549 missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50661213 missense probably damaging 1.00
R1830:Trps1 UTSW 15 50661136 missense probably damaging 0.99
R2083:Trps1 UTSW 15 50822305 missense probably damaging 1.00
R2167:Trps1 UTSW 15 50831730 missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50822398 missense probably damaging 1.00
R2314:Trps1 UTSW 15 50661346 missense probably damaging 1.00
R4133:Trps1 UTSW 15 50831387 missense probably damaging 1.00
R4223:Trps1 UTSW 15 50846648 missense probably benign
R4280:Trps1 UTSW 15 50846082 missense probably benign 0.00
R4566:Trps1 UTSW 15 50831678 missense probably damaging 1.00
R4810:Trps1 UTSW 15 50822296 missense probably benign 0.14
R4828:Trps1 UTSW 15 50660677 makesense probably null
R4838:Trps1 UTSW 15 50827316 missense probably benign 0.05
R4852:Trps1 UTSW 15 50846309 missense probably damaging 1.00
R5001:Trps1 UTSW 15 50661307 missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50664760 missense probably damaging 1.00
R5463:Trps1 UTSW 15 50831890 nonsense probably null
R5677:Trps1 UTSW 15 50846108 missense probably damaging 1.00
R5691:Trps1 UTSW 15 50827304 missense probably benign
R6432:Trps1 UTSW 15 50831397 missense probably damaging 0.96
R6528:Trps1 UTSW 15 50822427 missense probably benign 0.01
R6594:Trps1 UTSW 15 50830955 missense probably damaging 0.99
R6827:Trps1 UTSW 15 50822563 missense probably benign 0.14
R6862:Trps1 UTSW 15 50831605 critical splice donor site probably null
R6912:Trps1 UTSW 15 50822298 missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50822397 missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7857:Trps1 UTSW 15 50661005 missense probably damaging 1.00
R7929:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7940:Trps1 UTSW 15 50661005 missense probably damaging 1.00
V7580:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7581:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7583:Trps1 UTSW 15 50831577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACATTAGAGTGGAGTAGCAATG -3'
(R):5'- CTATGGCAATGACCCCACAG -3'

Sequencing Primer
(F):5'- TGGAGTAGCAATGAGATACATCCATC -3'
(R):5'- ACAGATCTGATTAAGCACTTCCG -3'
Posted On2015-03-18