Incidental Mutation 'R3736:Ctps'
ID270110
Institutional Source Beutler Lab
Gene Symbol Ctps
Ensembl Gene ENSMUSG00000028633
Gene Namecytidine 5'-triphosphate synthase
Synonyms
MMRRC Submission 040723-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R3736 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location120539868-120570276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120543746 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 459 (T459A)
Ref Sequence ENSEMBL: ENSMUSP00000030381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030381]
Predicted Effect probably benign
Transcript: ENSMUST00000030381
AA Change: T459A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030381
Gene: ENSMUSG00000028633
AA Change: T459A

DomainStartEndE-ValueType
Pfam:CTP_synth_N 2 277 2.8e-135 PFAM
Pfam:GATase 309 546 6.7e-55 PFAM
Pfam:Peptidase_C26 378 528 3.8e-10 PFAM
low complexity region 565 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147980
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme responsible for the catalytic conversion of UTP (uridine triphosphate) to CTP (cytidine triphospate). This reaction is an important step in the biosynthesis of phospholipids and nucleic acids. Activity of this proten is important in the immune system, and loss of function of this gene has been associated with immunodeficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4930432E11Rik G A 7: 29,574,571 noncoding transcript Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adgrf2 T C 17: 42,711,012 E307G probably benign Het
Ang2 G A 14: 51,195,656 R90* probably null Het
Ankrd11 A T 8: 122,891,785 V1776D probably damaging Het
Atp12a G A 14: 56,374,427 V353I possibly damaging Het
Bbs7 A G 3: 36,607,670 Y127H possibly damaging Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Ccdc162 T C 10: 41,589,568 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Clcn3 T A 8: 60,983,652 probably benign Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Evi5 A T 5: 107,818,983 V224D probably damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Kcnk10 A G 12: 98,489,912 V203A probably benign Het
Lef1 C T 3: 131,191,066 P160S possibly damaging Het
Lrmp G A 6: 145,160,870 probably benign Het
Lyn G T 4: 3,745,330 W78C probably damaging Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Morc3 T A 16: 93,874,812 V910E probably damaging Het
Mrvi1 A G 7: 110,923,963 V297A probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nup210l A G 3: 90,120,013 Y234C probably damaging Het
Olfr502 A G 7: 108,523,419 V177A possibly damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Pde4dip A T 3: 97,724,111 F1161I probably damaging Het
Poc5 A G 13: 96,396,816 S151G probably damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Shtn1 A T 19: 59,022,268 S256T probably benign Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tas2r134 C A 2: 51,627,774 N88K probably damaging Het
Tbc1d32 A G 10: 56,129,093 Y815H probably damaging Het
Tnrc6b G C 15: 80,889,163 probably benign Het
Vti1a T A 19: 55,380,932 probably null Het
Zfp273 T A 13: 67,825,507 C251* probably null Het
Zfp683 C A 4: 134,057,431 Q330K probably benign Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Zscan4d T C 7: 11,162,876 N189S probably benign Het
Other mutations in Ctps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Ctps APN 4 120552944 missense probably damaging 1.00
IGL00919:Ctps APN 4 120567348 missense probably benign 0.03
IGL01510:Ctps APN 4 120558844 missense probably damaging 0.98
IGL01686:Ctps APN 4 120553986 missense probably benign
IGL01897:Ctps APN 4 120567279 missense probably damaging 1.00
IGL02261:Ctps APN 4 120542579 missense possibly damaging 0.53
IGL02797:Ctps APN 4 120562824 missense probably benign 0.03
R0125:Ctps UTSW 4 120561525 splice site probably benign
R1053:Ctps UTSW 4 120543722 splice site probably null
R2087:Ctps UTSW 4 120562815 missense probably benign 0.12
R3928:Ctps UTSW 4 120541896 missense probably benign
R3929:Ctps UTSW 4 120541896 missense probably benign
R4193:Ctps UTSW 4 120548138 missense probably damaging 1.00
R4389:Ctps UTSW 4 120558790 missense probably damaging 1.00
R4853:Ctps UTSW 4 120554010 missense probably damaging 1.00
R5045:Ctps UTSW 4 120552878 critical splice donor site probably null
R5074:Ctps UTSW 4 120553973 missense probably damaging 1.00
R5566:Ctps UTSW 4 120554103 splice site probably null
R6235:Ctps UTSW 4 120558806 missense probably benign 0.42
R6828:Ctps UTSW 4 120548138 missense probably damaging 1.00
R7232:Ctps UTSW 4 120548124 missense probably damaging 1.00
R7487:Ctps UTSW 4 120558800 missense probably damaging 1.00
X0027:Ctps UTSW 4 120554093 missense probably damaging 1.00
X0062:Ctps UTSW 4 120542617 missense probably benign
Z1176:Ctps UTSW 4 120542743 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGATGCACTACCATAGCTCATCTAG -3'
(R):5'- GGAGGCTGAAGCATTGAGTTC -3'

Sequencing Primer
(F):5'- TCATCTAGCTAACACCATACATCC -3'
(R):5'- GAAGCATTGAGTTCCTGCCCTG -3'
Posted On2015-03-18