Incidental Mutation 'R3736:Zscan4d'
ID 270123
Institutional Source Beutler Lab
Gene Symbol Zscan4d
Ensembl Gene ENSMUSG00000090714
Gene Name zinc finger and SCAN domain containing 4D
Synonyms EG545913
MMRRC Submission 040723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R3736 (G1)
Quality Score 196
Status Validated
Chromosome 7
Chromosomal Location 11161374-11166159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11162876 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 189 (N189S)
Ref Sequence ENSEMBL: ENSMUSP00000066504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067210] [ENSMUST00000165848]
AlphaFold A7KBS4
Predicted Effect probably benign
Transcript: ENSMUST00000067210
AA Change: N189S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066504
Gene: ENSMUSG00000090714
AA Change: N189S

DomainStartEndE-ValueType
Pfam:SCAN 39 126 2.5e-19 PFAM
low complexity region 181 197 N/A INTRINSIC
ZnF_C2H2 395 417 5.14e-3 SMART
ZnF_C2H2 424 446 7.68e0 SMART
ZnF_C2H2 452 474 4.17e-3 SMART
ZnF_C2H2 480 503 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165848
AA Change: N189S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131258
Gene: ENSMUSG00000110103
AA Change: N189S

DomainStartEndE-ValueType
Pfam:SCAN 43 122 1.3e-17 PFAM
low complexity region 181 197 N/A INTRINSIC
ZnF_C2H2 395 417 5.14e-3 SMART
ZnF_C2H2 424 446 7.68e0 SMART
ZnF_C2H2 452 474 4.17e-3 SMART
ZnF_C2H2 480 503 3.83e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4930432E11Rik G A 7: 29,574,571 noncoding transcript Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adgrf2 T C 17: 42,711,012 E307G probably benign Het
Ang2 G A 14: 51,195,656 R90* probably null Het
Ankrd11 A T 8: 122,891,785 V1776D probably damaging Het
Atp12a G A 14: 56,374,427 V353I possibly damaging Het
Bbs7 A G 3: 36,607,670 Y127H possibly damaging Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Ccdc162 T C 10: 41,589,568 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Clcn3 T A 8: 60,983,652 probably benign Het
Ctps T C 4: 120,543,746 T459A probably benign Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Evi5 A T 5: 107,818,983 V224D probably damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Kcnk10 A G 12: 98,489,912 V203A probably benign Het
Lef1 C T 3: 131,191,066 P160S possibly damaging Het
Lrmp G A 6: 145,160,870 probably benign Het
Lyn G T 4: 3,745,330 W78C probably damaging Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Morc3 T A 16: 93,874,812 V910E probably damaging Het
Mrvi1 A G 7: 110,923,963 V297A probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nup210l A G 3: 90,120,013 Y234C probably damaging Het
Olfr502 A G 7: 108,523,419 V177A possibly damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Pde4dip A T 3: 97,724,111 F1161I probably damaging Het
Poc5 A G 13: 96,396,816 S151G probably damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Shtn1 A T 19: 59,022,268 S256T probably benign Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tas2r134 C A 2: 51,627,774 N88K probably damaging Het
Tbc1d32 A G 10: 56,129,093 Y815H probably damaging Het
Tnrc6b G C 15: 80,889,163 probably benign Het
Vti1a T A 19: 55,380,932 probably null Het
Zfp273 T A 13: 67,825,507 C251* probably null Het
Zfp683 C A 4: 134,057,431 Q330K probably benign Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Other mutations in Zscan4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Zscan4d APN 7 11162354 missense probably benign 0.00
IGL01576:Zscan4d APN 7 11162592 missense possibly damaging 0.91
IGL01926:Zscan4d APN 7 11164994 missense probably damaging 0.98
IGL02008:Zscan4d APN 7 11162369 missense probably benign 0.00
IGL02245:Zscan4d APN 7 11162789 missense probably benign
IGL02473:Zscan4d APN 7 11162409 missense probably benign 0.04
IGL02805:Zscan4d APN 7 11164970 splice site probably benign
IGL03010:Zscan4d APN 7 11163143 missense probably damaging 0.98
IGL03383:Zscan4d APN 7 11162765 missense probably benign 0.07
R0626:Zscan4d UTSW 7 11165019 missense probably damaging 0.97
R1084:Zscan4d UTSW 7 11165005 missense probably damaging 0.99
R1457:Zscan4d UTSW 7 11164994 missense probably damaging 0.98
R2426:Zscan4d UTSW 7 11165095 missense probably damaging 0.99
R2912:Zscan4d UTSW 7 11162687 missense probably benign
R4379:Zscan4d UTSW 7 11164978 missense probably benign
R4580:Zscan4d UTSW 7 11162508 missense probably benign 0.00
R4765:Zscan4d UTSW 7 11162667 missense probably benign 0.08
R4975:Zscan4d UTSW 7 11165347 start codon destroyed probably null 0.02
R6452:Zscan4d UTSW 7 11162072 missense probably damaging 0.98
R6570:Zscan4d UTSW 7 11162000 missense possibly damaging 0.92
R6680:Zscan4d UTSW 7 11162439 missense possibly damaging 0.85
R7726:Zscan4d UTSW 7 11165242 missense possibly damaging 0.65
R7772:Zscan4d UTSW 7 11162843 missense probably benign 0.28
R8282:Zscan4d UTSW 7 11162442 missense possibly damaging 0.91
R8320:Zscan4d UTSW 7 11066015 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCACTCCGGAAGTCTACATG -3'
(R):5'- GTCATCAAGCTTTTGAAACAACAGC -3'

Sequencing Primer
(F):5'- CTCCGGAAGTCTACATGATGACTG -3'
(R):5'- GCTTTTGAAACAACAGCAATCTGC -3'
Posted On 2015-03-18