Mutagenetix > Incidental Mutations

Incidental Mutation 'R3736:Zscan4d'

270123

Institutional Source

Beutler Lab

Gene Symbol

Zscan4d

Ensembl Gene

ENSMUSG00000090714

Gene Name

zinc finger and SCAN domain containing 4D

Synonyms

EG545913

MMRRC Submission

040723-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R3736 (G1)

Quality Score

196

Status

Validated

Chromosome

Chromosomal Location

11161374-11166159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 11162876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 189 (N189S)

Ref Sequence

ENSEMBL: ENSMUSP00000066504 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067210] [ENSMUST00000165848]

AlphaFold

A7KBS4

Predicted Effect

probably benign
Transcript: ENSMUST00000067210
AA Change: N189S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066504
Gene: ENSMUSG00000090714
AA Change: N189S

Domain	Start	End	E-Value	Type
Pfam:SCAN	39	126	2.5e-19	PFAM
low complexity region	181	197	N/A	INTRINSIC
ZnF_C2H2	395	417	5.14e-3	SMART
ZnF_C2H2	424	446	7.68e0	SMART
ZnF_C2H2	452	474	4.17e-3	SMART
ZnF_C2H2	480	503	3.83e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165848
AA Change: N189S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000131258
Gene: ENSMUSG00000110103
AA Change: N189S

Domain	Start	End	E-Value	Type
Pfam:SCAN	43	122	1.3e-17	PFAM
low complexity region	181	197	N/A	INTRINSIC
ZnF_C2H2	395	417	5.14e-3	SMART
ZnF_C2H2	424	446	7.68e0	SMART
ZnF_C2H2	452	474	4.17e-3	SMART
ZnF_C2H2	480	503	3.83e-2	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C02Rik	A	T	5: 30,482,098	Y123F	probably benign	Het
4930432E11Rik	G	A	7: 29,574,571		noncoding transcript	Het
Acot12	T	A	13: 91,784,346	I487N	probably benign	Het
Acox3	A	G	5: 35,611,153	K686R	probably benign	Het
Adgrf2	T	C	17: 42,711,012	E307G	probably benign	Het
Ang2	G	A	14: 51,195,656	R90*	probably null	Het
Ankrd11	A	T	8: 122,891,785	V1776D	probably damaging	Het
Atp12a	G	A	14: 56,374,427	V353I	possibly damaging	Het
Bbs7	A	G	3: 36,607,670	Y127H	possibly damaging	Het
C8a	T	C	4: 104,817,615	E509G	probably benign	Het
Ccdc158	A	C	5: 92,632,424	L930R	possibly damaging	Het
Ccdc162	T	C	10: 41,589,568		probably null	Het
Cep170b	A	T	12: 112,741,004	I395F	probably damaging	Het
Clcn3	T	A	8: 60,983,652		probably benign	Het
Ctps	T	C	4: 120,543,746	T459A	probably benign	Het
Cyp2j8	T	A	4: 96,444,599	R503S	probably damaging	Het
Dync1h1	G	A	12: 110,631,675	V1767I	probably benign	Het
Evi5	A	T	5: 107,818,983	V224D	probably damaging	Het
F8	G	A	X: 75,211,375	P2138S	probably damaging	Het
Helq	T	G	5: 100,790,188	D464A	possibly damaging	Het
Kcnk10	A	G	12: 98,489,912	V203A	probably benign	Het
Lef1	C	T	3: 131,191,066	P160S	possibly damaging	Het
Lrmp	G	A	6: 145,160,870		probably benign	Het
Lyn	G	T	4: 3,745,330	W78C	probably damaging	Het
Med12l	T	A	3: 59,091,495	H614Q	probably damaging	Het
Mogs	C	A	6: 83,116,776	T242K	possibly damaging	Het
Morc3	T	A	16: 93,874,812	V910E	probably damaging	Het
Mrvi1	A	G	7: 110,923,963	V297A	probably benign	Het
Ncapg	A	T	5: 45,696,127	Q906L	probably benign	Het
Nup210l	A	G	3: 90,120,013	Y234C	probably damaging	Het
Olfr502	A	G	7: 108,523,419	V177A	possibly damaging	Het
Olr1	T	A	6: 129,499,875		probably benign	Het
Osmr	A	T	15: 6,822,080	Y656N	probably damaging	Het
Pde4dip	A	T	3: 97,724,111	F1161I	probably damaging	Het
Poc5	A	G	13: 96,396,816	S151G	probably damaging	Het
Rmnd5a	T	C	6: 71,396,862	D316G	possibly damaging	Het
Shroom3	T	C	5: 92,964,444	V1888A	possibly damaging	Het
Shtn1	A	T	19: 59,022,268	S256T	probably benign	Het
Sptlc2	G	A	12: 87,341,565	A381V	probably benign	Het
Suclg2	T	A	6: 95,497,696	I363F	probably damaging	Het
Tas2r134	C	A	2: 51,627,774	N88K	probably damaging	Het
Tbc1d32	A	G	10: 56,129,093	Y815H	probably damaging	Het
Tnrc6b	G	C	15: 80,889,163		probably benign	Het
Vti1a	T	A	19: 55,380,932		probably null	Het
Zfp273	T	A	13: 67,825,507	C251*	probably null	Het
Zfp683	C	A	4: 134,057,431	Q330K	probably benign	Het
Zfpm1	G	A	8: 122,323,736	C117Y	possibly damaging	Het

Other mutations in Zscan4d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Zscan4d	APN	7	11162354	missense	probably benign	0.00
IGL01576:Zscan4d	APN	7	11162592	missense	possibly damaging	0.91
IGL01926:Zscan4d	APN	7	11164994	missense	probably damaging	0.98
IGL02008:Zscan4d	APN	7	11162369	missense	probably benign	0.00
IGL02245:Zscan4d	APN	7	11162789	missense	probably benign
IGL02473:Zscan4d	APN	7	11162409	missense	probably benign	0.04
IGL02805:Zscan4d	APN	7	11164970	splice site	probably benign
IGL03010:Zscan4d	APN	7	11163143	missense	probably damaging	0.98
IGL03383:Zscan4d	APN	7	11162765	missense	probably benign	0.07
R0626:Zscan4d	UTSW	7	11165019	missense	probably damaging	0.97
R1084:Zscan4d	UTSW	7	11165005	missense	probably damaging	0.99
R1457:Zscan4d	UTSW	7	11164994	missense	probably damaging	0.98
R2426:Zscan4d	UTSW	7	11165095	missense	probably damaging	0.99
R2912:Zscan4d	UTSW	7	11162687	missense	probably benign
R4379:Zscan4d	UTSW	7	11164978	missense	probably benign
R4580:Zscan4d	UTSW	7	11162508	missense	probably benign	0.00
R4765:Zscan4d	UTSW	7	11162667	missense	probably benign	0.08
R4975:Zscan4d	UTSW	7	11165347	start codon destroyed	probably null	0.02
R6452:Zscan4d	UTSW	7	11162072	missense	probably damaging	0.98
R6570:Zscan4d	UTSW	7	11162000	missense	possibly damaging	0.92
R6680:Zscan4d	UTSW	7	11162439	missense	possibly damaging	0.85
R7726:Zscan4d	UTSW	7	11165242	missense	possibly damaging	0.65
R7772:Zscan4d	UTSW	7	11162843	missense	probably benign	0.28
R8282:Zscan4d	UTSW	7	11162442	missense	possibly damaging	0.91
R8320:Zscan4d	UTSW	7	11066015	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCACTCCGGAAGTCTACATG -3'
(R):5'- GTCATCAAGCTTTTGAAACAACAGC -3'

Sequencing Primer
(F):5'- CTCCGGAAGTCTACATGATGACTG -3'
(R):5'- GCTTTTGAAACAACAGCAATCTGC -3'

Posted On

2015-03-18