Incidental Mutation 'R3736:Tbc1d32'
ID270131
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene NameTBC1 domain family, member 32
SynonymsD630037F22Rik, C6orf170, Bromi, b2b2284Clo
MMRRC Submission 040723-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R3736 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location56014293-56228689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56129093 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 815 (Y815H)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
Predicted Effect probably damaging
Transcript: ENSMUST00000099739
AA Change: Y815H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: Y815H

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219385
Meta Mutation Damage Score 0.2699 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4930432E11Rik G A 7: 29,574,571 noncoding transcript Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adgrf2 T C 17: 42,711,012 E307G probably benign Het
Ang2 G A 14: 51,195,656 R90* probably null Het
Ankrd11 A T 8: 122,891,785 V1776D probably damaging Het
Atp12a G A 14: 56,374,427 V353I possibly damaging Het
Bbs7 A G 3: 36,607,670 Y127H possibly damaging Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Ccdc162 T C 10: 41,589,568 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Clcn3 T A 8: 60,983,652 probably benign Het
Ctps T C 4: 120,543,746 T459A probably benign Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Evi5 A T 5: 107,818,983 V224D probably damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Kcnk10 A G 12: 98,489,912 V203A probably benign Het
Lef1 C T 3: 131,191,066 P160S possibly damaging Het
Lrmp G A 6: 145,160,870 probably benign Het
Lyn G T 4: 3,745,330 W78C probably damaging Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Morc3 T A 16: 93,874,812 V910E probably damaging Het
Mrvi1 A G 7: 110,923,963 V297A probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nup210l A G 3: 90,120,013 Y234C probably damaging Het
Olfr502 A G 7: 108,523,419 V177A possibly damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Pde4dip A T 3: 97,724,111 F1161I probably damaging Het
Poc5 A G 13: 96,396,816 S151G probably damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Shtn1 A T 19: 59,022,268 S256T probably benign Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tas2r134 C A 2: 51,627,774 N88K probably damaging Het
Tnrc6b G C 15: 80,889,163 probably benign Het
Vti1a T A 19: 55,380,932 probably null Het
Zfp273 T A 13: 67,825,507 C251* probably null Het
Zfp683 C A 4: 134,057,431 Q330K probably benign Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Zscan4d T C 7: 11,162,876 N189S probably benign Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56155765 missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56215125 splice site probably benign
IGL00835:Tbc1d32 APN 10 56089846 splice site probably benign
IGL01013:Tbc1d32 APN 10 56201959 splice site probably null
IGL01306:Tbc1d32 APN 10 56180524 missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56215080 missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 56123577 missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56151775 missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 56088403 missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56224619 missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56198542 missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56198491 missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 56017703 missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56180524 missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56198439 missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 56017605 missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56192898 missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56173963 missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56224640 missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56180576 missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56161147 missense probably benign
R1432:Tbc1d32 UTSW 10 56017662 missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56177479 splice site probably benign
R1708:Tbc1d32 UTSW 10 56151769 missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 56017604 missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 56123537 nonsense probably null
R2208:Tbc1d32 UTSW 10 56150792 critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56173915 missense probably benign 0.08
R4184:Tbc1d32 UTSW 10 56224580 missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 56049771 missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56170904 missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56224649 missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56196836 missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 56049029 splice site probably null
R5031:Tbc1d32 UTSW 10 56123531 missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56195404 nonsense probably null
R5276:Tbc1d32 UTSW 10 56151818 missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56170937 missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 56027993 missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 56040150 missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56195475 missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56129150 missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56150877 missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 56088393 missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56215062 missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 56088337 missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56162208 missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56150883 missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56195429 missense probably benign
R6422:Tbc1d32 UTSW 10 56028061 nonsense probably null
R6508:Tbc1d32 UTSW 10 56224690 missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56180530 missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56151811 nonsense probably null
R7012:Tbc1d32 UTSW 10 56224724 missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56198441 missense probably benign
R7288:Tbc1d32 UTSW 10 56051387 critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56151833 missense possibly damaging 0.92
R8338:Tbc1d32 UTSW 10 56028077 missense possibly damaging 0.85
R8814:Tbc1d32 UTSW 10 56196592 missense possibly damaging 0.93
Z1188:Tbc1d32 UTSW 10 56170881 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTTGAACCAAAGTTTTCACTGG -3'
(R):5'- AAGCTATCTTCATAGACATTCGGCTC -3'

Sequencing Primer
(F):5'- TTCACTGGTAGATAAGTCAAAGGTG -3'
(R):5'- GACATTCGGCTCTAACATTTACAC -3'
Posted On2015-03-18