Mutagenetix > Incidental Mutation

Incidental Mutation 'R3736:Tbc1d32'

270131

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d32

Ensembl Gene

ENSMUSG00000038122

Gene Name

TBC1 domain family, member 32

Synonyms

D630037F22Rik, C6orf170, Bromi, b2b2284Clo

MMRRC Submission

040723-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.903) question?

Stock #

R3736 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56014293-56228689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 56129093 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 815 (Y815H)

Ref Sequence

ENSEMBL: ENSMUSP00000097328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099739]

AlphaFold

Q3URV1

Predicted Effect

probably damaging
Transcript: ENSMUST00000099739
AA Change: Y815H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: Y815H

Domain	Start	End	E-Value	Type
Pfam:BROMI	12	1293	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219385

Meta Mutation Damage Score

0.2699

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C02Rik	A	T	5: 30,482,098	Y123F	probably benign	Het
4930432E11Rik	G	A	7: 29,574,571		noncoding transcript	Het
Acot12	T	A	13: 91,784,346	I487N	probably benign	Het
Acox3	A	G	5: 35,611,153	K686R	probably benign	Het
Adgrf2	T	C	17: 42,711,012	E307G	probably benign	Het
Ang2	G	A	14: 51,195,656	R90*	probably null	Het
Ankrd11	A	T	8: 122,891,785	V1776D	probably damaging	Het
Atp12a	G	A	14: 56,374,427	V353I	possibly damaging	Het
Bbs7	A	G	3: 36,607,670	Y127H	possibly damaging	Het
C8a	T	C	4: 104,817,615	E509G	probably benign	Het
Ccdc158	A	C	5: 92,632,424	L930R	possibly damaging	Het
Ccdc162	T	C	10: 41,589,568		probably null	Het
Cep170b	A	T	12: 112,741,004	I395F	probably damaging	Het
Clcn3	T	A	8: 60,983,652		probably benign	Het
Ctps	T	C	4: 120,543,746	T459A	probably benign	Het
Cyp2j8	T	A	4: 96,444,599	R503S	probably damaging	Het
Dync1h1	G	A	12: 110,631,675	V1767I	probably benign	Het
Evi5	A	T	5: 107,818,983	V224D	probably damaging	Het
F8	G	A	X: 75,211,375	P2138S	probably damaging	Het
Helq	T	G	5: 100,790,188	D464A	possibly damaging	Het
Kcnk10	A	G	12: 98,489,912	V203A	probably benign	Het
Lef1	C	T	3: 131,191,066	P160S	possibly damaging	Het
Lrmp	G	A	6: 145,160,870		probably benign	Het
Lyn	G	T	4: 3,745,330	W78C	probably damaging	Het
Med12l	T	A	3: 59,091,495	H614Q	probably damaging	Het
Mogs	C	A	6: 83,116,776	T242K	possibly damaging	Het
Morc3	T	A	16: 93,874,812	V910E	probably damaging	Het
Mrvi1	A	G	7: 110,923,963	V297A	probably benign	Het
Ncapg	A	T	5: 45,696,127	Q906L	probably benign	Het
Nup210l	A	G	3: 90,120,013	Y234C	probably damaging	Het
Olfr502	A	G	7: 108,523,419	V177A	possibly damaging	Het
Olr1	T	A	6: 129,499,875		probably benign	Het
Osmr	A	T	15: 6,822,080	Y656N	probably damaging	Het
Pde4dip	A	T	3: 97,724,111	F1161I	probably damaging	Het
Poc5	A	G	13: 96,396,816	S151G	probably damaging	Het
Rmnd5a	T	C	6: 71,396,862	D316G	possibly damaging	Het
Shroom3	T	C	5: 92,964,444	V1888A	possibly damaging	Het
Shtn1	A	T	19: 59,022,268	S256T	probably benign	Het
Sptlc2	G	A	12: 87,341,565	A381V	probably benign	Het
Suclg2	T	A	6: 95,497,696	I363F	probably damaging	Het
Tas2r134	C	A	2: 51,627,774	N88K	probably damaging	Het
Tnrc6b	G	C	15: 80,889,163		probably benign	Het
Vti1a	T	A	19: 55,380,932		probably null	Het
Zfp273	T	A	13: 67,825,507	C251*	probably null	Het
Zfp683	C	A	4: 134,057,431	Q330K	probably benign	Het
Zfpm1	G	A	8: 122,323,736	C117Y	possibly damaging	Het
Zscan4d	T	C	7: 11,162,876	N189S	probably benign	Het

Other mutations in Tbc1d32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Tbc1d32	APN	10	56155765	missense	probably damaging	1.00
IGL00535:Tbc1d32	APN	10	56215125	splice site	probably benign
IGL00835:Tbc1d32	APN	10	56089846	splice site	probably benign
IGL01013:Tbc1d32	APN	10	56201959	splice site	probably null
IGL01306:Tbc1d32	APN	10	56180524	missense	probably benign	0.14
IGL01452:Tbc1d32	APN	10	56215080	missense	possibly damaging	0.71
IGL01668:Tbc1d32	APN	10	56123577	missense	probably benign	0.37
IGL02008:Tbc1d32	APN	10	56151775	missense	possibly damaging	0.71
IGL02076:Tbc1d32	APN	10	56088403	missense	possibly damaging	0.93
IGL02348:Tbc1d32	APN	10	56224619	missense	probably benign	0.06
IGL02476:Tbc1d32	APN	10	56198542	missense	possibly damaging	0.71
IGL02750:Tbc1d32	APN	10	56198491	missense	possibly damaging	0.95
IGL02893:Tbc1d32	APN	10	56017703	missense	probably damaging	0.98
ANU23:Tbc1d32	UTSW	10	56180524	missense	probably benign	0.14
P0035:Tbc1d32	UTSW	10	56198439	missense	probably damaging	1.00
R0118:Tbc1d32	UTSW	10	56017605	missense	probably benign	0.02
R0446:Tbc1d32	UTSW	10	56192898	missense	possibly damaging	0.93
R0567:Tbc1d32	UTSW	10	56173963	missense	possibly damaging	0.71
R0615:Tbc1d32	UTSW	10	56224640	missense	probably benign	0.33
R0679:Tbc1d32	UTSW	10	56180576	missense	probably damaging	0.99
R0943:Tbc1d32	UTSW	10	56161147	missense	probably benign
R1432:Tbc1d32	UTSW	10	56017662	missense	probably damaging	0.99
R1454:Tbc1d32	UTSW	10	56177479	splice site	probably benign
R1708:Tbc1d32	UTSW	10	56151769	missense	possibly damaging	0.84
R1834:Tbc1d32	UTSW	10	56017604	missense	probably benign	0.00
R1860:Tbc1d32	UTSW	10	56123537	nonsense	probably null
R2208:Tbc1d32	UTSW	10	56150792	critical splice donor site	probably null
R3012:Tbc1d32	UTSW	10	56173915	missense	probably benign	0.08
R4184:Tbc1d32	UTSW	10	56224580	missense	probably benign	0.15
R4259:Tbc1d32	UTSW	10	56049771	missense	probably damaging	0.97
R4617:Tbc1d32	UTSW	10	56170904	missense	possibly damaging	0.92
R4700:Tbc1d32	UTSW	10	56224649	missense	probably damaging	0.98
R4794:Tbc1d32	UTSW	10	56196836	missense	possibly damaging	0.92
R4879:Tbc1d32	UTSW	10	56049029	splice site	probably null
R5031:Tbc1d32	UTSW	10	56123531	missense	probably damaging	0.98
R5036:Tbc1d32	UTSW	10	56195404	nonsense	probably null
R5276:Tbc1d32	UTSW	10	56151818	missense	probably damaging	0.99
R5358:Tbc1d32	UTSW	10	56170937	missense	possibly damaging	0.93
R5429:Tbc1d32	UTSW	10	56027993	missense	probably damaging	0.99
R5435:Tbc1d32	UTSW	10	56040150	missense	probably damaging	0.98
R5451:Tbc1d32	UTSW	10	56195475	missense	possibly damaging	0.95
R5607:Tbc1d32	UTSW	10	56129150	missense	possibly damaging	0.92
R5642:Tbc1d32	UTSW	10	56150877	missense	possibly damaging	0.82
R5732:Tbc1d32	UTSW	10	56088393	missense	probably damaging	0.99
R5795:Tbc1d32	UTSW	10	56215062	missense	possibly damaging	0.71
R5988:Tbc1d32	UTSW	10	56088337	missense	probably damaging	0.98
R6054:Tbc1d32	UTSW	10	56162208	missense	possibly damaging	0.95
R6103:Tbc1d32	UTSW	10	56150883	missense	probably damaging	0.99
R6277:Tbc1d32	UTSW	10	56195429	missense	probably benign
R6422:Tbc1d32	UTSW	10	56028061	nonsense	probably null
R6508:Tbc1d32	UTSW	10	56224690	missense	probably damaging	0.98
R6859:Tbc1d32	UTSW	10	56180530	missense	probably damaging	0.98
R6887:Tbc1d32	UTSW	10	56151811	nonsense	probably null
R7012:Tbc1d32	UTSW	10	56224724	missense	probably damaging	0.99
R7253:Tbc1d32	UTSW	10	56198441	missense	probably benign
R7288:Tbc1d32	UTSW	10	56051387	critical splice donor site	probably null
R7599:Tbc1d32	UTSW	10	56151833	missense	possibly damaging	0.92
R8338:Tbc1d32	UTSW	10	56028077	missense	possibly damaging	0.85
R8814:Tbc1d32	UTSW	10	56196592	missense	possibly damaging	0.93
R8864:Tbc1d32	UTSW	10	56087559	missense	probably benign	0.01
R9018:Tbc1d32	UTSW	10	56072597	missense	probably benign	0.02
R9030:Tbc1d32	UTSW	10	56161145	missense	possibly damaging	0.92
R9530:Tbc1d32	UTSW	10	56196411	missense	probably damaging	0.98
R9616:Tbc1d32	UTSW	10	56161150	missense	possibly damaging	0.85
Z1188:Tbc1d32	UTSW	10	56170881	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTCTTGAACCAAAGTTTTCACTGG -3'
(R):5'- AAGCTATCTTCATAGACATTCGGCTC -3'

Sequencing Primer
(F):5'- TTCACTGGTAGATAAGTCAAAGGTG -3'
(R):5'- GACATTCGGCTCTAACATTTACAC -3'

Posted On

2015-03-18