Mutagenetix > Incidental Mutations

Incidental Mutation 'R3736:Tnrc6b'

270142

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

040723-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.240) question?

Stock #

R3736 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to C at 80889163 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689] [ENSMUST00000227449]

Predicted Effect

probably benign
Transcript: ENSMUST00000067689

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000227449

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228071

Predicted Effect

probably benign
Transcript: ENSMUST00000228124

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228320

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (53/53)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C02Rik	A	T	5: 30,482,098	Y123F	probably benign	Het
4930432E11Rik	G	A	7: 29,574,571		noncoding transcript	Het
Acot12	T	A	13: 91,784,346	I487N	probably benign	Het
Acox3	A	G	5: 35,611,153	K686R	probably benign	Het
Adgrf2	T	C	17: 42,711,012	E307G	probably benign	Het
Ang2	G	A	14: 51,195,656	R90*	probably null	Het
Ankrd11	A	T	8: 122,891,785	V1776D	probably damaging	Het
Atp12a	G	A	14: 56,374,427	V353I	possibly damaging	Het
Bbs7	A	G	3: 36,607,670	Y127H	possibly damaging	Het
C8a	T	C	4: 104,817,615	E509G	probably benign	Het
Ccdc158	A	C	5: 92,632,424	L930R	possibly damaging	Het
Ccdc162	T	C	10: 41,589,568		probably null	Het
Cep170b	A	T	12: 112,741,004	I395F	probably damaging	Het
Clcn3	T	A	8: 60,983,652		probably benign	Het
Ctps	T	C	4: 120,543,746	T459A	probably benign	Het
Cyp2j8	T	A	4: 96,444,599	R503S	probably damaging	Het
Dync1h1	G	A	12: 110,631,675	V1767I	probably benign	Het
Evi5	A	T	5: 107,818,983	V224D	probably damaging	Het
F8	G	A	X: 75,211,375	P2138S	probably damaging	Het
Helq	T	G	5: 100,790,188	D464A	possibly damaging	Het
Kcnk10	A	G	12: 98,489,912	V203A	probably benign	Het
Lef1	C	T	3: 131,191,066	P160S	possibly damaging	Het
Lrmp	G	A	6: 145,160,870		probably benign	Het
Lyn	G	T	4: 3,745,330	W78C	probably damaging	Het
Med12l	T	A	3: 59,091,495	H614Q	probably damaging	Het
Mogs	C	A	6: 83,116,776	T242K	possibly damaging	Het
Morc3	T	A	16: 93,874,812	V910E	probably damaging	Het
Mrvi1	A	G	7: 110,923,963	V297A	probably benign	Het
Ncapg	A	T	5: 45,696,127	Q906L	probably benign	Het
Nup210l	A	G	3: 90,120,013	Y234C	probably damaging	Het
Olfr502	A	G	7: 108,523,419	V177A	possibly damaging	Het
Olr1	T	A	6: 129,499,875		probably benign	Het
Osmr	A	T	15: 6,822,080	Y656N	probably damaging	Het
Pde4dip	A	T	3: 97,724,111	F1161I	probably damaging	Het
Poc5	A	G	13: 96,396,816	S151G	probably damaging	Het
Rmnd5a	T	C	6: 71,396,862	D316G	possibly damaging	Het
Shroom3	T	C	5: 92,964,444	V1888A	possibly damaging	Het
Shtn1	A	T	19: 59,022,268	S256T	probably benign	Het
Sptlc2	G	A	12: 87,341,565	A381V	probably benign	Het
Suclg2	T	A	6: 95,497,696	I363F	probably damaging	Het
Tas2r134	C	A	2: 51,627,774	N88K	probably damaging	Het
Tbc1d32	A	G	10: 56,129,093	Y815H	probably damaging	Het
Vti1a	T	A	19: 55,380,932		probably null	Het
Zfp273	T	A	13: 67,825,507	C251*	probably null	Het
Zfp683	C	A	4: 134,057,431	Q330K	probably benign	Het
Zfpm1	G	A	8: 122,323,736	C117Y	possibly damaging	Het
Zscan4d	T	C	7: 11,162,876	N189S	probably benign	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	unclassified	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	unclassified	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R7914:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- AGAGTAGAGAGGCTTTGTCCC -3'
(R):5'- CCCAATCACCTGTTGACGTC -3'

Sequencing Primer
(F):5'- GAGGGGACATTGATTCCTGAC -3'
(R):5'- AATCACCTGTTGACGTCAGTTAC -3'

Posted On

2015-03-18