Incidental Mutation 'R3737:Ifi203'
ID270150
Institutional Source Beutler Lab
Gene Symbol Ifi203
Ensembl Gene ENSMUSG00000039997
Gene Nameinterferon activated gene 203
Synonyms
MMRRC Submission 040724-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3737 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173920407-173942672 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 173929474 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042228] [ENSMUST00000081216] [ENSMUST00000111210] [ENSMUST00000123708] [ENSMUST00000129829] [ENSMUST00000156895]
Predicted Effect probably benign
Transcript: ENSMUST00000042228
SMART Domains Protein: ENSMUSP00000042071
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081216
SMART Domains Protein: ENSMUSP00000079976
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123708
SMART Domains Protein: ENSMUSP00000121480
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128430
Predicted Effect unknown
Transcript: ENSMUST00000129829
AA Change: T248S
SMART Domains Protein: ENSMUSP00000122424
Gene: ENSMUSG00000039997
AA Change: T248S

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
Pfam:HIN 665 831 7.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138143
Predicted Effect probably benign
Transcript: ENSMUST00000156895
SMART Domains Protein: ENSMUSP00000114221
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Arap1 A T 7: 101,400,277 Y982F possibly damaging Het
Bicral A T 17: 46,825,910 Y125N probably damaging Het
Brd2 A G 17: 34,117,080 L53S probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cdk17 G A 10: 93,221,644 probably null Het
Clca3a1 A G 3: 144,730,721 V867A probably benign Het
Dchs1 T A 7: 105,762,316 D1531V possibly damaging Het
Dnah9 G A 11: 66,156,908 Q29* probably null Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Fgfbp1 T C 5: 43,979,596 Y118C probably damaging Het
Gal3st2c A G 1: 94,009,328 I332V possibly damaging Het
Gprc6a A C 10: 51,626,911 N285K probably benign Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Il1f5 T C 2: 24,281,203 F101S probably damaging Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Kctd9 G A 14: 67,734,288 D157N possibly damaging Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Mon2 A G 10: 123,013,375 L1340P probably damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Nolc1 CAG CAGTAG 19: 46,081,353 probably benign Het
Nolc1 GCA GCAACA 19: 46,081,370 probably benign Het
Nolc1 C CAGT 19: 46,081,377 probably benign Het
Olfr878 G A 9: 37,918,641 probably benign Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Pcm1 T A 8: 41,261,043 Y215* probably null Het
Pde6c T A 19: 38,140,224 V212D probably damaging Het
Ppl T C 16: 5,106,857 T115A probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
R3hcc1 C T 14: 69,697,593 R262Q probably benign Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Ska3 A T 14: 57,811,596 M306K probably benign Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tprgl T C 4: 154,160,128 I137V probably benign Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ube2j1 A T 4: 33,036,723 M16L probably benign Het
Ubr3 G A 2: 69,971,234 probably null Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Usp49 G A 17: 47,672,318 V83M probably damaging Het
Usp6nl C A 2: 6,440,917 N568K probably damaging Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn1r55 T G 7: 5,147,196 D76A probably damaging Het
Xrcc6 T C 15: 82,029,631 Y53H probably damaging Het
Zbtb7c T G 18: 76,136,940 L33R probably damaging Het
Other mutations in Ifi203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Ifi203 APN 1 173937740 critical splice donor site probably null
IGL02598:Ifi203 APN 1 173935002 splice site probably benign
IGL03172:Ifi203 APN 1 173936592 missense possibly damaging 0.94
IGL03334:Ifi203 APN 1 173937835 nonsense probably null
FR4304:Ifi203 UTSW 1 173928328 intron probably benign
R0593:Ifi203 UTSW 1 173928649 intron probably benign
R0827:Ifi203 UTSW 1 173928463 intron probably benign
R1163:Ifi203 UTSW 1 173924137 missense probably damaging 0.98
R1769:Ifi203 UTSW 1 173928760 nonsense probably null
R3415:Ifi203 UTSW 1 173928760 nonsense probably null
R3738:Ifi203 UTSW 1 173929474 intron probably benign
R3739:Ifi203 UTSW 1 173929474 intron probably benign
R3791:Ifi203 UTSW 1 173935080 missense possibly damaging 0.83
R3847:Ifi203 UTSW 1 173933796 missense possibly damaging 0.84
R4035:Ifi203 UTSW 1 173929474 intron probably benign
R4156:Ifi203 UTSW 1 173936540 missense probably damaging 0.98
R4164:Ifi203 UTSW 1 173928463 intron probably benign
R4171:Ifi203 UTSW 1 173933775 splice site probably benign
R4200:Ifi203 UTSW 1 173924115 missense probably damaging 0.99
R4233:Ifi203 UTSW 1 173936533 missense possibly damaging 0.92
R4845:Ifi203 UTSW 1 173927029 missense probably benign 0.00
R4880:Ifi203 UTSW 1 173929150 intron probably benign
R5071:Ifi203 UTSW 1 173935110 missense possibly damaging 0.92
R5108:Ifi203 UTSW 1 173924014 missense probably damaging 1.00
R5284:Ifi203 UTSW 1 173928708 intron probably benign
R5335:Ifi203 UTSW 1 173926919 missense possibly damaging 0.71
R6198:Ifi203 UTSW 1 173924082 missense probably damaging 0.97
R6236:Ifi203 UTSW 1 173933913 missense probably benign 0.33
R6397:Ifi203 UTSW 1 173927204 missense probably benign 0.33
R6929:Ifi203 UTSW 1 173928774 intron probably benign
R7025:Ifi203 UTSW 1 173928385 intron probably benign
R7149:Ifi203 UTSW 1 173928928 missense unknown
R7320:Ifi203 UTSW 1 173929167 missense unknown
R7631:Ifi203 UTSW 1 173927122 missense unknown
R7913:Ifi203 UTSW 1 173926957 missense probably damaging 1.00
R8183:Ifi203 UTSW 1 173928700 missense unknown
R8297:Ifi203 UTSW 1 173937930 missense probably damaging 1.00
Z1088:Ifi203 UTSW 1 173928581 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGACACTGGAAGATTGTGGC -3'
(R):5'- CTAAGTGGTAGCCTAAGTGTGG -3'

Sequencing Primer
(F):5'- TGATGTTGGAGAGATTGGAGACATC -3'
(R):5'- CTGACAGGATAAAAGTCCTC -3'
Posted On2015-03-18