Incidental Mutation 'R3737:Ifi203'
ID 270150
Institutional Source Beutler Lab
Gene Symbol Ifi203
Ensembl Gene ENSMUSG00000039997
Gene Name interferon activated gene 203
Synonyms
MMRRC Submission 040724-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R3737 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 173747973-173770238 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 173757040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042228] [ENSMUST00000081216] [ENSMUST00000111210] [ENSMUST00000123708] [ENSMUST00000129829] [ENSMUST00000156895]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042228
SMART Domains Protein: ENSMUSP00000042071
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081216
SMART Domains Protein: ENSMUSP00000079976
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123708
SMART Domains Protein: ENSMUSP00000121480
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128430
Predicted Effect unknown
Transcript: ENSMUST00000129829
AA Change: T248S
SMART Domains Protein: ENSMUSP00000122424
Gene: ENSMUSG00000039997
AA Change: T248S

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
Pfam:HIN 665 831 7.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138143
Predicted Effect probably benign
Transcript: ENSMUST00000156895
SMART Domains Protein: ENSMUSP00000114221
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Api5 C T 2: 94,255,958 (GRCm39) R243Q possibly damaging Het
Arap1 A T 7: 101,049,484 (GRCm39) Y982F possibly damaging Het
Bicral A T 17: 47,136,836 (GRCm39) Y125N probably damaging Het
Brd2 A G 17: 34,336,054 (GRCm39) L53S probably benign Het
Ccdc88c G A 12: 100,896,783 (GRCm39) A1389V possibly damaging Het
Cdk17 G A 10: 93,057,506 (GRCm39) probably null Het
Clca3a1 A G 3: 144,436,482 (GRCm39) V867A probably benign Het
Dchs1 T A 7: 105,411,523 (GRCm39) D1531V possibly damaging Het
Dnah9 G A 11: 66,047,734 (GRCm39) Q29* probably null Het
Dop1a T C 9: 86,376,486 (GRCm39) V240A probably damaging Het
Fgfbp1 T C 5: 44,136,938 (GRCm39) Y118C probably damaging Het
Gal3st2c A G 1: 93,937,050 (GRCm39) I332V possibly damaging Het
Gprc6a A C 10: 51,503,007 (GRCm39) N285K probably benign Het
Hcn4 A G 9: 58,751,172 (GRCm39) D266G probably benign Het
Hmcn2 A T 2: 31,226,624 (GRCm39) K200* probably null Het
Hmgcr C G 13: 96,787,571 (GRCm39) L852F probably damaging Het
Il36rn T C 2: 24,171,215 (GRCm39) F101S probably damaging Het
Isl2 A G 9: 55,449,754 (GRCm39) S119G probably benign Het
Kctd9 G A 14: 67,971,737 (GRCm39) D157N possibly damaging Het
Lcorl A T 5: 45,891,383 (GRCm39) N323K possibly damaging Het
Ltbp2 A T 12: 84,851,248 (GRCm39) C836S probably damaging Het
Mfsd2b A G 12: 4,920,578 (GRCm39) S80P probably damaging Het
Mon2 A G 10: 122,849,280 (GRCm39) L1340P probably damaging Het
Myh9 G A 15: 77,651,012 (GRCm39) R1612C probably damaging Het
Nlrp4f T C 13: 65,341,821 (GRCm39) N608S probably benign Het
Nolc1 C CAGT 19: 46,069,816 (GRCm39) probably benign Het
Nolc1 CAG CAGTAG 19: 46,069,792 (GRCm39) probably benign Het
Nolc1 GCA GCAACA 19: 46,069,809 (GRCm39) probably benign Het
Or8b4 G A 9: 37,829,937 (GRCm39) probably benign Het
Osbpl2 G A 2: 179,803,353 (GRCm39) R475H probably damaging Het
Pcm1 T A 8: 41,714,080 (GRCm39) Y215* probably null Het
Pde6c T A 19: 38,128,672 (GRCm39) V212D probably damaging Het
Ppl T C 16: 4,924,721 (GRCm39) T115A probably benign Het
Prtg G T 9: 72,749,991 (GRCm39) E132* probably null Het
R3hcc1 C T 14: 69,935,042 (GRCm39) R262Q probably benign Het
Serpinb6d T A 13: 33,851,663 (GRCm39) V140E probably damaging Het
Ska3 A T 14: 58,049,053 (GRCm39) M306K probably benign Het
Spesp1 T A 9: 62,180,318 (GRCm39) I197L probably benign Het
Srsf4 C T 4: 131,627,413 (GRCm39) probably benign Het
Tprg1l T C 4: 154,244,585 (GRCm39) I137V probably benign Het
Ttk C A 9: 83,736,890 (GRCm39) P450T possibly damaging Het
Ube2j1 A T 4: 33,036,723 (GRCm39) M16L probably benign Het
Ubr3 G A 2: 69,801,578 (GRCm39) probably null Het
Usp42 C T 5: 143,701,194 (GRCm39) S943N probably benign Het
Usp49 G A 17: 47,983,243 (GRCm39) V83M probably damaging Het
Usp6nl C A 2: 6,445,728 (GRCm39) N568K probably damaging Het
Utp20 C T 10: 88,598,668 (GRCm39) V103I probably benign Het
Vmn1r55 T G 7: 5,150,195 (GRCm39) D76A probably damaging Het
Xrcc6 T C 15: 81,913,832 (GRCm39) Y53H probably damaging Het
Zbtb7c T G 18: 76,270,011 (GRCm39) L33R probably damaging Het
Other mutations in Ifi203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Ifi203 APN 1 173,765,306 (GRCm39) critical splice donor site probably null
IGL02598:Ifi203 APN 1 173,762,568 (GRCm39) splice site probably benign
IGL03172:Ifi203 APN 1 173,764,158 (GRCm39) missense possibly damaging 0.94
IGL03334:Ifi203 APN 1 173,765,401 (GRCm39) nonsense probably null
FR4304:Ifi203 UTSW 1 173,755,894 (GRCm39) intron probably benign
R0593:Ifi203 UTSW 1 173,756,215 (GRCm39) intron probably benign
R0827:Ifi203 UTSW 1 173,756,029 (GRCm39) intron probably benign
R1163:Ifi203 UTSW 1 173,751,703 (GRCm39) missense probably damaging 0.98
R1769:Ifi203 UTSW 1 173,756,326 (GRCm39) nonsense probably null
R3415:Ifi203 UTSW 1 173,756,326 (GRCm39) nonsense probably null
R3738:Ifi203 UTSW 1 173,757,040 (GRCm39) intron probably benign
R3739:Ifi203 UTSW 1 173,757,040 (GRCm39) intron probably benign
R3791:Ifi203 UTSW 1 173,762,646 (GRCm39) missense possibly damaging 0.83
R3847:Ifi203 UTSW 1 173,761,362 (GRCm39) missense possibly damaging 0.84
R4035:Ifi203 UTSW 1 173,757,040 (GRCm39) intron probably benign
R4156:Ifi203 UTSW 1 173,764,106 (GRCm39) missense probably damaging 0.98
R4164:Ifi203 UTSW 1 173,756,029 (GRCm39) intron probably benign
R4171:Ifi203 UTSW 1 173,761,341 (GRCm39) splice site probably benign
R4200:Ifi203 UTSW 1 173,751,681 (GRCm39) missense probably damaging 0.99
R4233:Ifi203 UTSW 1 173,764,099 (GRCm39) missense possibly damaging 0.92
R4845:Ifi203 UTSW 1 173,754,595 (GRCm39) missense probably benign 0.00
R4880:Ifi203 UTSW 1 173,756,716 (GRCm39) intron probably benign
R5071:Ifi203 UTSW 1 173,762,676 (GRCm39) missense possibly damaging 0.92
R5108:Ifi203 UTSW 1 173,751,580 (GRCm39) missense probably damaging 1.00
R5284:Ifi203 UTSW 1 173,756,274 (GRCm39) intron probably benign
R5335:Ifi203 UTSW 1 173,754,485 (GRCm39) missense possibly damaging 0.71
R6198:Ifi203 UTSW 1 173,751,648 (GRCm39) missense probably damaging 0.97
R6236:Ifi203 UTSW 1 173,761,479 (GRCm39) missense probably benign 0.33
R6397:Ifi203 UTSW 1 173,754,770 (GRCm39) missense probably benign 0.33
R6929:Ifi203 UTSW 1 173,756,340 (GRCm39) intron probably benign
R7025:Ifi203 UTSW 1 173,755,951 (GRCm39) intron probably benign
R7149:Ifi203 UTSW 1 173,756,494 (GRCm39) missense unknown
R7320:Ifi203 UTSW 1 173,756,733 (GRCm39) missense unknown
R7631:Ifi203 UTSW 1 173,754,688 (GRCm39) missense unknown
R7913:Ifi203 UTSW 1 173,754,523 (GRCm39) missense probably damaging 1.00
R8183:Ifi203 UTSW 1 173,756,266 (GRCm39) missense unknown
R8297:Ifi203 UTSW 1 173,765,496 (GRCm39) missense probably damaging 1.00
R8537:Ifi203 UTSW 1 173,756,472 (GRCm39) intron probably benign
R8919:Ifi203 UTSW 1 173,756,494 (GRCm39) missense unknown
R8936:Ifi203 UTSW 1 173,756,857 (GRCm39) intron probably benign
R9081:Ifi203 UTSW 1 173,757,048 (GRCm39) missense unknown
R9223:Ifi203 UTSW 1 173,765,437 (GRCm39) missense probably benign 0.42
R9255:Ifi203 UTSW 1 173,756,787 (GRCm39) missense unknown
R9351:Ifi203 UTSW 1 173,750,133 (GRCm39) missense probably benign 0.33
R9397:Ifi203 UTSW 1 173,765,547 (GRCm39) missense probably damaging 0.99
R9506:Ifi203 UTSW 1 173,751,565 (GRCm39) missense possibly damaging 0.93
R9586:Ifi203 UTSW 1 173,754,623 (GRCm39) nonsense probably null
R9598:Ifi203 UTSW 1 173,751,522 (GRCm39) missense probably damaging 1.00
Z1088:Ifi203 UTSW 1 173,756,147 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- AGACACTGGAAGATTGTGGC -3'
(R):5'- CTAAGTGGTAGCCTAAGTGTGG -3'

Sequencing Primer
(F):5'- TGATGTTGGAGAGATTGGAGACATC -3'
(R):5'- CTGACAGGATAAAAGTCCTC -3'
Posted On 2015-03-18