Incidental Mutation 'R3737:Lcorl'
ID 270164
Institutional Source Beutler Lab
Gene Symbol Lcorl
Ensembl Gene ENSMUSG00000015882
Gene Name ligand dependent nuclear receptor corepressor-like
Synonyms A830039H10Rik, Mlr1
MMRRC Submission 040724-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.305) question?
Stock # R3737 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 45854523-46014957 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45891383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 323 (N323K)
Ref Sequence ENSEMBL: ENSMUSP00000084408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016026] [ENSMUST00000045586] [ENSMUST00000087164] [ENSMUST00000121573] [ENSMUST00000190036]
AlphaFold Q3U285
Predicted Effect probably benign
Transcript: ENSMUST00000016026
AA Change: N406K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000016026
Gene: ENSMUSG00000015882
AA Change: N406K

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Pfam:HTH_psq 276 313 5.1e-9 PFAM
Pfam:HTH_psq 525 570 1.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045586
SMART Domains Protein: ENSMUSP00000042677
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087164
AA Change: N323K

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084408
Gene: ENSMUSG00000015882
AA Change: N323K

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Pfam:HTH_psq 193 230 3.4e-7 PFAM
Pfam:HTH_psq 442 487 9.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121573
SMART Domains Protein: ENSMUSP00000112416
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190036
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that appears to function in spermatogenesis. Polymorphisms in this gene are associated with measures of skeletal frame size and adult height. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Api5 C T 2: 94,255,958 (GRCm39) R243Q possibly damaging Het
Arap1 A T 7: 101,049,484 (GRCm39) Y982F possibly damaging Het
Bicral A T 17: 47,136,836 (GRCm39) Y125N probably damaging Het
Brd2 A G 17: 34,336,054 (GRCm39) L53S probably benign Het
Ccdc88c G A 12: 100,896,783 (GRCm39) A1389V possibly damaging Het
Cdk17 G A 10: 93,057,506 (GRCm39) probably null Het
Clca3a1 A G 3: 144,436,482 (GRCm39) V867A probably benign Het
Dchs1 T A 7: 105,411,523 (GRCm39) D1531V possibly damaging Het
Dnah9 G A 11: 66,047,734 (GRCm39) Q29* probably null Het
Dop1a T C 9: 86,376,486 (GRCm39) V240A probably damaging Het
Fgfbp1 T C 5: 44,136,938 (GRCm39) Y118C probably damaging Het
Gal3st2c A G 1: 93,937,050 (GRCm39) I332V possibly damaging Het
Gprc6a A C 10: 51,503,007 (GRCm39) N285K probably benign Het
Hcn4 A G 9: 58,751,172 (GRCm39) D266G probably benign Het
Hmcn2 A T 2: 31,226,624 (GRCm39) K200* probably null Het
Hmgcr C G 13: 96,787,571 (GRCm39) L852F probably damaging Het
Ifi203 T A 1: 173,757,040 (GRCm39) probably benign Het
Il36rn T C 2: 24,171,215 (GRCm39) F101S probably damaging Het
Isl2 A G 9: 55,449,754 (GRCm39) S119G probably benign Het
Kctd9 G A 14: 67,971,737 (GRCm39) D157N possibly damaging Het
Ltbp2 A T 12: 84,851,248 (GRCm39) C836S probably damaging Het
Mfsd2b A G 12: 4,920,578 (GRCm39) S80P probably damaging Het
Mon2 A G 10: 122,849,280 (GRCm39) L1340P probably damaging Het
Myh9 G A 15: 77,651,012 (GRCm39) R1612C probably damaging Het
Nlrp4f T C 13: 65,341,821 (GRCm39) N608S probably benign Het
Nolc1 C CAGT 19: 46,069,816 (GRCm39) probably benign Het
Nolc1 CAG CAGTAG 19: 46,069,792 (GRCm39) probably benign Het
Nolc1 GCA GCAACA 19: 46,069,809 (GRCm39) probably benign Het
Or8b4 G A 9: 37,829,937 (GRCm39) probably benign Het
Osbpl2 G A 2: 179,803,353 (GRCm39) R475H probably damaging Het
Pcm1 T A 8: 41,714,080 (GRCm39) Y215* probably null Het
Pde6c T A 19: 38,128,672 (GRCm39) V212D probably damaging Het
Ppl T C 16: 4,924,721 (GRCm39) T115A probably benign Het
Prtg G T 9: 72,749,991 (GRCm39) E132* probably null Het
R3hcc1 C T 14: 69,935,042 (GRCm39) R262Q probably benign Het
Serpinb6d T A 13: 33,851,663 (GRCm39) V140E probably damaging Het
Ska3 A T 14: 58,049,053 (GRCm39) M306K probably benign Het
Spesp1 T A 9: 62,180,318 (GRCm39) I197L probably benign Het
Srsf4 C T 4: 131,627,413 (GRCm39) probably benign Het
Tprg1l T C 4: 154,244,585 (GRCm39) I137V probably benign Het
Ttk C A 9: 83,736,890 (GRCm39) P450T possibly damaging Het
Ube2j1 A T 4: 33,036,723 (GRCm39) M16L probably benign Het
Ubr3 G A 2: 69,801,578 (GRCm39) probably null Het
Usp42 C T 5: 143,701,194 (GRCm39) S943N probably benign Het
Usp49 G A 17: 47,983,243 (GRCm39) V83M probably damaging Het
Usp6nl C A 2: 6,445,728 (GRCm39) N568K probably damaging Het
Utp20 C T 10: 88,598,668 (GRCm39) V103I probably benign Het
Vmn1r55 T G 7: 5,150,195 (GRCm39) D76A probably damaging Het
Xrcc6 T C 15: 81,913,832 (GRCm39) Y53H probably damaging Het
Zbtb7c T G 18: 76,270,011 (GRCm39) L33R probably damaging Het
Other mutations in Lcorl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Lcorl APN 5 45,904,637 (GRCm39) missense probably damaging 1.00
IGL01611:Lcorl APN 5 45,904,434 (GRCm39) missense probably damaging 1.00
IGL03014:Lcorl UTSW 5 45,931,371 (GRCm39) intron probably benign
R0070:Lcorl UTSW 5 45,891,043 (GRCm39) missense probably damaging 1.00
R0070:Lcorl UTSW 5 45,891,043 (GRCm39) missense probably damaging 1.00
R0499:Lcorl UTSW 5 45,891,711 (GRCm39) missense probably benign 0.00
R1518:Lcorl UTSW 5 45,891,543 (GRCm39) missense possibly damaging 0.94
R1817:Lcorl UTSW 5 45,952,688 (GRCm39) missense probably damaging 1.00
R1977:Lcorl UTSW 5 45,932,762 (GRCm39) missense probably null 0.16
R2171:Lcorl UTSW 5 45,904,493 (GRCm39) missense probably damaging 0.99
R3738:Lcorl UTSW 5 45,891,383 (GRCm39) missense possibly damaging 0.95
R3739:Lcorl UTSW 5 45,891,383 (GRCm39) missense possibly damaging 0.95
R3825:Lcorl UTSW 5 45,932,729 (GRCm39) splice site probably benign
R4035:Lcorl UTSW 5 45,891,383 (GRCm39) missense possibly damaging 0.95
R4199:Lcorl UTSW 5 45,891,130 (GRCm39) missense possibly damaging 0.83
R4583:Lcorl UTSW 5 45,890,931 (GRCm39) nonsense probably null
R4647:Lcorl UTSW 5 45,890,931 (GRCm39) nonsense probably null
R4803:Lcorl UTSW 5 45,904,623 (GRCm39) unclassified probably null
R5524:Lcorl UTSW 5 45,932,865 (GRCm39) critical splice acceptor site probably null
R5524:Lcorl UTSW 5 45,932,864 (GRCm39) critical splice acceptor site probably null
R5526:Lcorl UTSW 5 45,891,069 (GRCm39) missense probably benign
R5533:Lcorl UTSW 5 45,891,219 (GRCm39) missense possibly damaging 0.47
R5772:Lcorl UTSW 5 45,952,709 (GRCm39) splice site probably null
R5927:Lcorl UTSW 5 45,882,766 (GRCm39) intron probably benign
R6175:Lcorl UTSW 5 45,933,832 (GRCm39) missense probably damaging 1.00
R6734:Lcorl UTSW 5 45,890,839 (GRCm39) missense probably damaging 0.98
R6864:Lcorl UTSW 5 45,904,546 (GRCm39) missense probably damaging 1.00
R7078:Lcorl UTSW 5 45,904,566 (GRCm39) missense probably damaging 1.00
R7396:Lcorl UTSW 5 46,014,801 (GRCm39) splice site probably null
R7624:Lcorl UTSW 5 45,859,307 (GRCm39) missense probably benign
R9008:Lcorl UTSW 5 45,931,516 (GRCm39) intron probably benign
R9354:Lcorl UTSW 5 45,890,968 (GRCm39) nonsense probably null
R9497:Lcorl UTSW 5 45,891,339 (GRCm39) missense probably benign
X0023:Lcorl UTSW 5 45,891,354 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGTGAGTTACAGGCCCAG -3'
(R):5'- AGAAACTTGTGCTGTGCTGC -3'

Sequencing Primer
(F):5'- TACAGGCCCAGAACAGTCTAGTTTG -3'
(R):5'- ACTTGTGCTGTGCTGCAAAAAG -3'
Posted On 2015-03-18