Incidental Mutation 'R3737:Lcorl'
ID270164
Institutional Source Beutler Lab
Gene Symbol Lcorl
Ensembl Gene ENSMUSG00000015882
Gene Nameligand dependent nuclear receptor corepressor-like
SynonymsMlr1, A830039H10Rik
MMRRC Submission 040724-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R3737 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location45697181-45857615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45734041 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 323 (N323K)
Ref Sequence ENSEMBL: ENSMUSP00000084408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016026] [ENSMUST00000045586] [ENSMUST00000087164] [ENSMUST00000121573] [ENSMUST00000190036]
Predicted Effect probably benign
Transcript: ENSMUST00000016026
AA Change: N406K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000016026
Gene: ENSMUSG00000015882
AA Change: N406K

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Pfam:HTH_psq 276 313 5.1e-9 PFAM
Pfam:HTH_psq 525 570 1.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045586
SMART Domains Protein: ENSMUSP00000042677
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087164
AA Change: N323K

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084408
Gene: ENSMUSG00000015882
AA Change: N323K

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Pfam:HTH_psq 193 230 3.4e-7 PFAM
Pfam:HTH_psq 442 487 9.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121573
SMART Domains Protein: ENSMUSP00000112416
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190036
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that appears to function in spermatogenesis. Polymorphisms in this gene are associated with measures of skeletal frame size and adult height. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Arap1 A T 7: 101,400,277 Y982F possibly damaging Het
Bicral A T 17: 46,825,910 Y125N probably damaging Het
Brd2 A G 17: 34,117,080 L53S probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cdk17 G A 10: 93,221,644 probably null Het
Clca3a1 A G 3: 144,730,721 V867A probably benign Het
Dchs1 T A 7: 105,762,316 D1531V possibly damaging Het
Dnah9 G A 11: 66,156,908 Q29* probably null Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Fgfbp1 T C 5: 43,979,596 Y118C probably damaging Het
Gal3st2c A G 1: 94,009,328 I332V possibly damaging Het
Gprc6a A C 10: 51,626,911 N285K probably benign Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ifi203 T A 1: 173,929,474 probably benign Het
Il1f5 T C 2: 24,281,203 F101S probably damaging Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Kctd9 G A 14: 67,734,288 D157N possibly damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Mon2 A G 10: 123,013,375 L1340P probably damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Nolc1 CAG CAGTAG 19: 46,081,353 probably benign Het
Nolc1 GCA GCAACA 19: 46,081,370 probably benign Het
Nolc1 C CAGT 19: 46,081,377 probably benign Het
Olfr878 G A 9: 37,918,641 probably benign Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Pcm1 T A 8: 41,261,043 Y215* probably null Het
Pde6c T A 19: 38,140,224 V212D probably damaging Het
Ppl T C 16: 5,106,857 T115A probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
R3hcc1 C T 14: 69,697,593 R262Q probably benign Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Ska3 A T 14: 57,811,596 M306K probably benign Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tprgl T C 4: 154,160,128 I137V probably benign Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ube2j1 A T 4: 33,036,723 M16L probably benign Het
Ubr3 G A 2: 69,971,234 probably null Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Usp49 G A 17: 47,672,318 V83M probably damaging Het
Usp6nl C A 2: 6,440,917 N568K probably damaging Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn1r55 T G 7: 5,147,196 D76A probably damaging Het
Xrcc6 T C 15: 82,029,631 Y53H probably damaging Het
Zbtb7c T G 18: 76,136,940 L33R probably damaging Het
Other mutations in Lcorl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Lcorl APN 5 45747295 missense probably damaging 1.00
IGL01611:Lcorl APN 5 45747092 missense probably damaging 1.00
IGL03014:Lcorl UTSW 5 45774029 intron probably benign
R0070:Lcorl UTSW 5 45733701 missense probably damaging 1.00
R0070:Lcorl UTSW 5 45733701 missense probably damaging 1.00
R0499:Lcorl UTSW 5 45734369 missense probably benign 0.00
R1518:Lcorl UTSW 5 45734201 missense possibly damaging 0.94
R1817:Lcorl UTSW 5 45795346 missense probably damaging 1.00
R1977:Lcorl UTSW 5 45775420 missense probably null 0.16
R2171:Lcorl UTSW 5 45747151 missense probably damaging 0.99
R3738:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3739:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3825:Lcorl UTSW 5 45775387 splice site probably benign
R4035:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R4199:Lcorl UTSW 5 45733788 missense possibly damaging 0.83
R4583:Lcorl UTSW 5 45733589 nonsense probably null
R4647:Lcorl UTSW 5 45733589 nonsense probably null
R4803:Lcorl UTSW 5 45747281 unclassified probably null
R5524:Lcorl UTSW 5 45775522 critical splice acceptor site probably null
R5524:Lcorl UTSW 5 45775523 critical splice acceptor site probably null
R5526:Lcorl UTSW 5 45733727 missense probably benign
R5533:Lcorl UTSW 5 45733877 missense possibly damaging 0.47
R5772:Lcorl UTSW 5 45795367 splice site probably null
R5927:Lcorl UTSW 5 45725424 intron probably benign
R6175:Lcorl UTSW 5 45776490 missense probably damaging 1.00
R6734:Lcorl UTSW 5 45733497 missense probably damaging 0.98
R6864:Lcorl UTSW 5 45747204 missense probably damaging 1.00
R7078:Lcorl UTSW 5 45747224 missense probably damaging 1.00
R7396:Lcorl UTSW 5 45857459 splice site probably null
R7624:Lcorl UTSW 5 45701965 missense probably benign
X0023:Lcorl UTSW 5 45734012 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGTGAGTTACAGGCCCAG -3'
(R):5'- AGAAACTTGTGCTGTGCTGC -3'

Sequencing Primer
(F):5'- TACAGGCCCAGAACAGTCTAGTTTG -3'
(R):5'- ACTTGTGCTGTGCTGCAAAAAG -3'
Posted On2015-03-18