Incidental Mutation 'R3737:Hmgcr'
ID270193
Institutional Source Beutler Lab
Gene Symbol Hmgcr
Ensembl Gene ENSMUSG00000021670
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A reductase
SynonymsHMG-CoAR, 3-hydroxy-3-methylglutaryl-CoA reductase, Red
MMRRC Submission 040724-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3737 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location96648967-96670936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 96651063 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 852 (L852F)
Ref Sequence ENSEMBL: ENSMUSP00000022176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022176] [ENSMUST00000168855] [ENSMUST00000169202] [ENSMUST00000170287]
Predicted Effect probably damaging
Transcript: ENSMUST00000022176
AA Change: L852F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022176
Gene: ENSMUSG00000021670
AA Change: L852F

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 342 2.7e-11 PFAM
Pfam:Sterol-sensing 85 234 3.4e-20 PFAM
Pfam:HMG-CoA_red 490 870 2.2e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168855
Predicted Effect probably benign
Transcript: ENSMUST00000169202
SMART Domains Protein: ENSMUSP00000132155
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
Pfam:HMG-CoA_red 35 219 8.8e-76 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000169945
AA Change: L129F
SMART Domains Protein: ENSMUSP00000128642
Gene: ENSMUSG00000021670
AA Change: L129F

DomainStartEndE-ValueType
Pfam:HMG-CoA_red 1 96 1.8e-37 PFAM
Pfam:HMG-CoA_red 96 148 2.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170287
SMART Domains Protein: ENSMUSP00000128939
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 347 1.4e-11 PFAM
Pfam:Sterol-sensing 85 234 7.4e-20 PFAM
Pfam:HMG-CoA_red 488 819 1.3e-148 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HMG-CoA reductase is the rate-limiting enzyme for cholesterol synthesis and is regulated via a negative feedback mechanism mediated by sterols and non-sterol metabolites derived from mevalonate, the product of the reaction catalyzed by reductase. Normally in mammalian cells this enzyme is suppressed by cholesterol derived from the internalization and degradation of low density lipoprotein (LDL) via the LDL receptor. Competitive inhibitors of the reductase induce the expression of LDL receptors in the liver, which in turn increases the catabolism of plasma LDL and lowers the plasma concentration of cholesterol, an important determinant of atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Inactivation of both copies of this gene results in early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Arap1 A T 7: 101,400,277 Y982F possibly damaging Het
Bicral A T 17: 46,825,910 Y125N probably damaging Het
Brd2 A G 17: 34,117,080 L53S probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cdk17 G A 10: 93,221,644 probably null Het
Clca3a1 A G 3: 144,730,721 V867A probably benign Het
Dchs1 T A 7: 105,762,316 D1531V possibly damaging Het
Dnah9 G A 11: 66,156,908 Q29* probably null Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Fgfbp1 T C 5: 43,979,596 Y118C probably damaging Het
Gal3st2c A G 1: 94,009,328 I332V possibly damaging Het
Gprc6a A C 10: 51,626,911 N285K probably benign Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Ifi203 T A 1: 173,929,474 probably benign Het
Il1f5 T C 2: 24,281,203 F101S probably damaging Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Kctd9 G A 14: 67,734,288 D157N possibly damaging Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Mon2 A G 10: 123,013,375 L1340P probably damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Nolc1 CAG CAGTAG 19: 46,081,353 probably benign Het
Nolc1 GCA GCAACA 19: 46,081,370 probably benign Het
Nolc1 C CAGT 19: 46,081,377 probably benign Het
Olfr878 G A 9: 37,918,641 probably benign Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Pcm1 T A 8: 41,261,043 Y215* probably null Het
Pde6c T A 19: 38,140,224 V212D probably damaging Het
Ppl T C 16: 5,106,857 T115A probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
R3hcc1 C T 14: 69,697,593 R262Q probably benign Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Ska3 A T 14: 57,811,596 M306K probably benign Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tprgl T C 4: 154,160,128 I137V probably benign Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ube2j1 A T 4: 33,036,723 M16L probably benign Het
Ubr3 G A 2: 69,971,234 probably null Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Usp49 G A 17: 47,672,318 V83M probably damaging Het
Usp6nl C A 2: 6,440,917 N568K probably damaging Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn1r55 T G 7: 5,147,196 D76A probably damaging Het
Xrcc6 T C 15: 82,029,631 Y53H probably damaging Het
Zbtb7c T G 18: 76,136,940 L33R probably damaging Het
Other mutations in Hmgcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Hmgcr APN 13 96659278 missense probably benign
IGL01369:Hmgcr APN 13 96666522 missense probably null 1.00
IGL01575:Hmgcr APN 13 96656595 missense possibly damaging 0.56
IGL02183:Hmgcr APN 13 96663127 missense probably damaging 1.00
IGL02515:Hmgcr APN 13 96666512 splice site probably benign
IGL02716:Hmgcr APN 13 96660012 critical splice acceptor site probably null
IGL03278:Hmgcr APN 13 96656762 splice site probably benign
IGL03367:Hmgcr APN 13 96665853 missense probably damaging 0.98
PIT4131001:Hmgcr UTSW 13 96659054 missense probably damaging 1.00
PIT4504001:Hmgcr UTSW 13 96663097 missense possibly damaging 0.95
R0003:Hmgcr UTSW 13 96652145 missense probably damaging 1.00
R0017:Hmgcr UTSW 13 96652089 splice site probably benign
R0017:Hmgcr UTSW 13 96652089 splice site probably benign
R0217:Hmgcr UTSW 13 96651980 missense probably damaging 1.00
R0511:Hmgcr UTSW 13 96660143 unclassified probably null
R0707:Hmgcr UTSW 13 96650643 unclassified probably benign
R1301:Hmgcr UTSW 13 96659020 missense probably damaging 0.97
R2203:Hmgcr UTSW 13 96656633 missense probably damaging 1.00
R2204:Hmgcr UTSW 13 96656633 missense probably damaging 1.00
R2433:Hmgcr UTSW 13 96665885 missense probably damaging 1.00
R2938:Hmgcr UTSW 13 96663068 missense probably damaging 0.99
R3159:Hmgcr UTSW 13 96665847 missense probably damaging 1.00
R3752:Hmgcr UTSW 13 96663116 missense probably damaging 1.00
R3837:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R3838:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R3839:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R4034:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R4035:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R4210:Hmgcr UTSW 13 96660221 missense probably damaging 1.00
R4783:Hmgcr UTSW 13 96666193 missense probably damaging 1.00
R4820:Hmgcr UTSW 13 96660192 missense probably damaging 1.00
R5090:Hmgcr UTSW 13 96650590 missense probably benign
R5113:Hmgcr UTSW 13 96656732 missense probably benign 0.00
R5209:Hmgcr UTSW 13 96666512 splice site probably benign
R5354:Hmgcr UTSW 13 96654896 missense probably benign 0.26
R5571:Hmgcr UTSW 13 96666663 missense probably benign 0.11
R5804:Hmgcr UTSW 13 96666187 missense probably damaging 0.98
R5886:Hmgcr UTSW 13 96660183 missense probably damaging 1.00
R6340:Hmgcr UTSW 13 96665858 missense probably damaging 1.00
R6638:Hmgcr UTSW 13 96658982 missense probably benign
R6699:Hmgcr UTSW 13 96660209 missense probably damaging 1.00
R7024:Hmgcr UTSW 13 96658910 missense probably benign 0.10
R7061:Hmgcr UTSW 13 96666148 missense possibly damaging 0.64
R7284:Hmgcr UTSW 13 96652665 missense probably damaging 1.00
R7286:Hmgcr UTSW 13 96666597 missense probably damaging 1.00
R7705:Hmgcr UTSW 13 96656723 missense probably benign 0.01
R7709:Hmgcr UTSW 13 96663097 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTCAGAAGACCACAAGGC -3'
(R):5'- CCAGCGTTTCTAATGGAGTTTAGG -3'

Sequencing Primer
(F):5'- TCAGTAGCCTGGAACTTGCCAAG -3'
(R):5'- GAGTTTAGGGCTCCTTCTCCG -3'
Posted On2015-03-18