Incidental Mutation 'R3737:Nolc1'
ID270208
Institutional Source Beutler Lab
Gene Symbol Nolc1
Ensembl Gene ENSMUSG00000015176
Gene Namenucleolar and coiled-body phosphoprotein 1
SynonymsNOPP140, 3230402K17Rik, P130
MMRRC Submission 040724-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3737 (G1)
Quality Score108
Status Not validated
Chromosome19
Chromosomal Location46075863-46085530 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GCA to GCAACA at 46081370 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000224490] [ENSMUST00000225780]
Predicted Effect probably benign
Transcript: ENSMUST00000165017
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223683
Predicted Effect probably benign
Transcript: ENSMUST00000223728
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224434
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225758
Predicted Effect probably benign
Transcript: ENSMUST00000225780
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Arap1 A T 7: 101,400,277 Y982F possibly damaging Het
Bicral A T 17: 46,825,910 Y125N probably damaging Het
Brd2 A G 17: 34,117,080 L53S probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cdk17 G A 10: 93,221,644 probably null Het
Clca3a1 A G 3: 144,730,721 V867A probably benign Het
Dchs1 T A 7: 105,762,316 D1531V possibly damaging Het
Dnah9 G A 11: 66,156,908 Q29* probably null Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Fgfbp1 T C 5: 43,979,596 Y118C probably damaging Het
Gal3st2c A G 1: 94,009,328 I332V possibly damaging Het
Gprc6a A C 10: 51,626,911 N285K probably benign Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ifi203 T A 1: 173,929,474 probably benign Het
Il1f5 T C 2: 24,281,203 F101S probably damaging Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Kctd9 G A 14: 67,734,288 D157N possibly damaging Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Mon2 A G 10: 123,013,375 L1340P probably damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Olfr878 G A 9: 37,918,641 probably benign Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Pcm1 T A 8: 41,261,043 Y215* probably null Het
Pde6c T A 19: 38,140,224 V212D probably damaging Het
Ppl T C 16: 5,106,857 T115A probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
R3hcc1 C T 14: 69,697,593 R262Q probably benign Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Ska3 A T 14: 57,811,596 M306K probably benign Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tprgl T C 4: 154,160,128 I137V probably benign Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ube2j1 A T 4: 33,036,723 M16L probably benign Het
Ubr3 G A 2: 69,971,234 probably null Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Usp49 G A 17: 47,672,318 V83M probably damaging Het
Usp6nl C A 2: 6,440,917 N568K probably damaging Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn1r55 T G 7: 5,147,196 D76A probably damaging Het
Xrcc6 T C 15: 82,029,631 Y53H probably damaging Het
Zbtb7c T G 18: 76,136,940 L33R probably damaging Het
Other mutations in Nolc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Nolc1 APN 19 46083029 unclassified probably benign
FR4976:Nolc1 UTSW 19 46081356 small insertion probably benign
FR4976:Nolc1 UTSW 19 46081375 small insertion probably benign
R0106:Nolc1 UTSW 19 46080089 splice site probably benign
R0121:Nolc1 UTSW 19 46081378 unclassified probably benign
R0140:Nolc1 UTSW 19 46081378 unclassified probably benign
R0501:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R0513:Nolc1 UTSW 19 46084159 missense probably damaging 1.00
R0676:Nolc1 UTSW 19 46080089 splice site probably benign
R1553:Nolc1 UTSW 19 46081375 small insertion probably benign
R1642:Nolc1 UTSW 19 46079022 critical splice donor site probably null
R1698:Nolc1 UTSW 19 46081431 splice site probably null
R2067:Nolc1 UTSW 19 46083607 missense probably damaging 1.00
R2113:Nolc1 UTSW 19 46081359 small insertion probably benign
R2113:Nolc1 UTSW 19 46081361 small insertion probably benign
R2300:Nolc1 UTSW 19 46081359 small insertion probably benign
R2300:Nolc1 UTSW 19 46081368 small insertion probably benign
R2895:Nolc1 UTSW 19 46081352 small insertion probably benign
R2999:Nolc1 UTSW 19 46083155 small deletion probably benign
R3737:Nolc1 UTSW 19 46081353 small insertion probably benign
R3737:Nolc1 UTSW 19 46081377 small insertion probably benign
R3747:Nolc1 UTSW 19 46081356 small insertion probably benign
R3806:Nolc1 UTSW 19 46081352 small insertion probably benign
R3807:Nolc1 UTSW 19 46081352 small insertion probably benign
R3807:Nolc1 UTSW 19 46081359 small insertion probably benign
R3807:Nolc1 UTSW 19 46081371 small insertion probably benign
R4035:Nolc1 UTSW 19 46081358 small insertion probably benign
R4619:Nolc1 UTSW 19 46083520 missense probably damaging 1.00
R4856:Nolc1 UTSW 19 46083155 small deletion probably benign
R4999:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R5103:Nolc1 UTSW 19 46081664 nonsense probably null
R5559:Nolc1 UTSW 19 46083155 small deletion probably benign
R5837:Nolc1 UTSW 19 46083183 unclassified probably benign
R6457:Nolc1 UTSW 19 46083070 unclassified probably benign
R7467:Nolc1 UTSW 19 46082334 missense unknown
R7497:Nolc1 UTSW 19 46082818 missense probably benign 0.23
R8011:Nolc1 UTSW 19 46081584 missense not run
RF027:Nolc1 UTSW 19 46081363 small insertion probably benign
RF031:Nolc1 UTSW 19 46081371 small insertion probably benign
RF034:Nolc1 UTSW 19 46081371 small insertion probably benign
RF040:Nolc1 UTSW 19 46081363 small insertion probably benign
RF044:Nolc1 UTSW 19 46081371 small insertion probably benign
X0050:Nolc1 UTSW 19 46081352 small deletion probably benign
Y5377:Nolc1 UTSW 19 46081369 small insertion probably benign
Y5379:Nolc1 UTSW 19 46081359 small insertion probably benign
Z1088:Nolc1 UTSW 19 46083098 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCATCTAGGCATCTCACTCAG -3'
(R):5'- TGGTACAGTCTTCATTGGAGAG -3'

Sequencing Primer
(F):5'- AGGCATCTCACTCAGGTCATC -3'
(R):5'- GAAAATTAACATTAGAGGAAAGCGCC -3'
Posted On2015-03-18