Incidental Mutation 'R3738:Ifi203'
ID270213
Institutional Source Beutler Lab
Gene Symbol Ifi203
Ensembl Gene ENSMUSG00000039997
Gene Nameinterferon activated gene 203
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3738 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173920407-173942672 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 173929474 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042228] [ENSMUST00000081216] [ENSMUST00000111210] [ENSMUST00000123708] [ENSMUST00000129829] [ENSMUST00000156895]
Predicted Effect probably benign
Transcript: ENSMUST00000042228
SMART Domains Protein: ENSMUSP00000042071
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081216
SMART Domains Protein: ENSMUSP00000079976
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123708
SMART Domains Protein: ENSMUSP00000121480
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128430
Predicted Effect unknown
Transcript: ENSMUST00000129829
AA Change: T248S
SMART Domains Protein: ENSMUSP00000122424
Gene: ENSMUSG00000039997
AA Change: T248S

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
Pfam:HIN 665 831 7.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138143
Predicted Effect probably benign
Transcript: ENSMUST00000156895
SMART Domains Protein: ENSMUSP00000114221
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Atp8b1 A G 18: 64,533,729 probably benign Het
Camk2d A G 3: 126,771,839 D136G probably damaging Het
Capn3 G A 2: 120,485,287 D227N possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Dlgap3 A G 4: 127,195,606 T332A probably damaging Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Fbxw18 T A 9: 109,688,913 Y335F possibly damaging Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm8251 A G 1: 44,058,866 V1024A probably benign Het
Insig1 T A 5: 28,071,703 I89N probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Jak1 T C 4: 101,191,468 probably benign Het
Kctd9 G A 14: 67,734,288 D157N possibly damaging Het
Kmt2c A C 5: 25,405,383 F242V probably benign Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Lin54 T C 5: 100,459,806 probably benign Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Nr1d2 T A 14: 18,211,804 N433I possibly damaging Het
Olfr1217 T C 2: 89,023,610 Y131C probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Olfr724 T C 14: 49,960,556 N172S possibly damaging Het
Pld4 T C 12: 112,768,035 I410T probably benign Het
Pnmal2 C T 7: 16,946,596 H502Y probably benign Het
Pramef8 T C 4: 143,416,642 probably benign Het
Rbbp8nl G T 2: 180,281,248 T184K probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Ska3 A T 14: 57,811,596 M306K probably benign Het
Slfn4 T C 11: 83,185,311 M1T probably null Het
Sorcs1 T C 19: 50,151,221 I1168V probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Trim9 T C 12: 70,251,195 T579A probably damaging Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ube2j1 A T 4: 33,036,723 M16L probably benign Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn2r62 G A 7: 42,787,887 P391L probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Ifi203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Ifi203 APN 1 173937740 critical splice donor site probably null
IGL02598:Ifi203 APN 1 173935002 splice site probably benign
IGL03172:Ifi203 APN 1 173936592 missense possibly damaging 0.94
IGL03334:Ifi203 APN 1 173937835 nonsense probably null
FR4304:Ifi203 UTSW 1 173928328 intron probably benign
R0593:Ifi203 UTSW 1 173928649 intron probably benign
R0827:Ifi203 UTSW 1 173928463 intron probably benign
R1163:Ifi203 UTSW 1 173924137 missense probably damaging 0.98
R1769:Ifi203 UTSW 1 173928760 nonsense probably null
R3415:Ifi203 UTSW 1 173928760 nonsense probably null
R3737:Ifi203 UTSW 1 173929474 intron probably benign
R3739:Ifi203 UTSW 1 173929474 intron probably benign
R3791:Ifi203 UTSW 1 173935080 missense possibly damaging 0.83
R3847:Ifi203 UTSW 1 173933796 missense possibly damaging 0.84
R4035:Ifi203 UTSW 1 173929474 intron probably benign
R4156:Ifi203 UTSW 1 173936540 missense probably damaging 0.98
R4164:Ifi203 UTSW 1 173928463 intron probably benign
R4171:Ifi203 UTSW 1 173933775 splice site probably benign
R4200:Ifi203 UTSW 1 173924115 missense probably damaging 0.99
R4233:Ifi203 UTSW 1 173936533 missense possibly damaging 0.92
R4845:Ifi203 UTSW 1 173927029 missense probably benign 0.00
R4880:Ifi203 UTSW 1 173929150 intron probably benign
R5071:Ifi203 UTSW 1 173935110 missense possibly damaging 0.92
R5108:Ifi203 UTSW 1 173924014 missense probably damaging 1.00
R5284:Ifi203 UTSW 1 173928708 intron probably benign
R5335:Ifi203 UTSW 1 173926919 missense possibly damaging 0.71
R6198:Ifi203 UTSW 1 173924082 missense probably damaging 0.97
R6236:Ifi203 UTSW 1 173933913 missense probably benign 0.33
R6397:Ifi203 UTSW 1 173927204 missense probably benign 0.33
R6929:Ifi203 UTSW 1 173928774 intron probably benign
R7025:Ifi203 UTSW 1 173928385 intron probably benign
R7149:Ifi203 UTSW 1 173928928 missense unknown
R7320:Ifi203 UTSW 1 173929167 missense unknown
R7631:Ifi203 UTSW 1 173927122 missense unknown
R7913:Ifi203 UTSW 1 173926957 missense probably damaging 1.00
R8183:Ifi203 UTSW 1 173928700 missense unknown
R8297:Ifi203 UTSW 1 173937930 missense probably damaging 1.00
Z1088:Ifi203 UTSW 1 173928581 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGACACTGGAAGATTGTGGC -3'
(R):5'- CTAAGTGGTAGCCTAAGTGTGG -3'

Sequencing Primer
(F):5'- TGATGTTGGAGAGATTGGAGACATC -3'
(R):5'- CTGACAGGATAAAAGTCCTC -3'
Posted On2015-03-18