Incidental Mutation 'R3738:Api5'
ID270215
Institutional Source Beutler Lab
Gene Symbol Api5
Ensembl Gene ENSMUSG00000027193
Gene Nameapoptosis inhibitor 5
SynonymsAAC-11
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R3738 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location94411682-94438136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94425613 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 243 (R243Q)
Ref Sequence ENSEMBL: ENSMUSP00000028617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028617
AA Change: R243Q

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028617
Gene: ENSMUSG00000027193
AA Change: R243Q

DomainStartEndE-ValueType
Pfam:API5 4 504 8.9e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152454
Meta Mutation Damage Score 0.1242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an apoptosis inhibitory protein whose expression prevents apoptosis after growth factor deprivation. This protein suppresses the transcription factor E2F1-induced apoptosis and also interacts with, and negatively regulates Acinus, a nuclear factor involved in apoptotic DNA fragmentation. Its depletion enhances the cytotoxic action of the chemotherapeutic drugs. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Atp8b1 A G 18: 64,533,729 probably benign Het
Camk2d A G 3: 126,771,839 D136G probably damaging Het
Capn3 G A 2: 120,485,287 D227N possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Dlgap3 A G 4: 127,195,606 T332A probably damaging Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Fbxw18 T A 9: 109,688,913 Y335F possibly damaging Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm8251 A G 1: 44,058,866 V1024A probably benign Het
Ifi203 T A 1: 173,929,474 probably benign Het
Insig1 T A 5: 28,071,703 I89N probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Jak1 T C 4: 101,191,468 probably benign Het
Kctd9 G A 14: 67,734,288 D157N possibly damaging Het
Kmt2c A C 5: 25,405,383 F242V probably benign Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Lin54 T C 5: 100,459,806 probably benign Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Nr1d2 T A 14: 18,211,804 N433I possibly damaging Het
Olfr1217 T C 2: 89,023,610 Y131C probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Olfr724 T C 14: 49,960,556 N172S possibly damaging Het
Pld4 T C 12: 112,768,035 I410T probably benign Het
Pnmal2 C T 7: 16,946,596 H502Y probably benign Het
Pramef8 T C 4: 143,416,642 probably benign Het
Rbbp8nl G T 2: 180,281,248 T184K probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Ska3 A T 14: 57,811,596 M306K probably benign Het
Slfn4 T C 11: 83,185,311 M1T probably null Het
Sorcs1 T C 19: 50,151,221 I1168V probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Trim9 T C 12: 70,251,195 T579A probably damaging Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ube2j1 A T 4: 33,036,723 M16L probably benign Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn2r62 G A 7: 42,787,887 P391L probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Api5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Api5 APN 2 94418954 splice site probably benign
IGL02203:Api5 APN 2 94425074 missense probably benign 0.00
IGL02346:Api5 APN 2 94427530 missense possibly damaging 0.77
IGL02605:Api5 APN 2 94429719 missense possibly damaging 0.88
IGL02646:Api5 APN 2 94429839 missense possibly damaging 0.62
R0018:Api5 UTSW 2 94420984 critical splice donor site probably null
R0149:Api5 UTSW 2 94423497 nonsense probably null
R0361:Api5 UTSW 2 94423497 nonsense probably null
R1554:Api5 UTSW 2 94425643 missense probably benign 0.14
R2507:Api5 UTSW 2 94429817 missense probably damaging 1.00
R3723:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R3724:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R3737:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R4035:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R4724:Api5 UTSW 2 94423471 missense possibly damaging 0.95
R5306:Api5 UTSW 2 94423466 nonsense probably null
R5337:Api5 UTSW 2 94425688 missense possibly damaging 0.94
R6577:Api5 UTSW 2 94422381 missense probably benign 0.24
R7031:Api5 UTSW 2 94425616 missense probably benign 0.01
R7936:Api5 UTSW 2 94438047 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAATGTCTTGCTGCCTTGGG -3'
(R):5'- AAATGCTGTTCTTCTCGATTGCG -3'

Sequencing Primer
(F):5'- TGGGTTCTTCCAGTGCCGC -3'
(R):5'- TTCTAGGTCCTAGAAGACGTGAC -3'
Posted On2015-03-18