Mutagenetix > Incidental Mutations

Incidental Mutation 'R3738:Jak1'

270221

Institutional Source

Beutler Lab

Gene Symbol

Jak1

Ensembl Gene

ENSMUSG00000028530

Gene Name

Janus kinase 1

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3738 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101152367-101265282 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 101191468 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102781] [ENSMUST00000149297]

Predicted Effect

probably benign
Transcript: ENSMUST00000102781

SMART Domains

Protein: ENSMUSP00000099842
Gene: ENSMUSG00000028530

Domain	Start	End	E-Value	Type
B41	32	286	2.45e-58	SMART
Blast:B41	291	420	4e-51	BLAST
SH2	437	531	1.85e-13	SMART
STYKc	582	844	6.72e-14	SMART
TyrKc	874	1148	9.01e-122	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132292

Predicted Effect

probably benign
Transcript: ENSMUST00000149297

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155328

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that is a member of a class of protein-tyrosine kinases (PTK) characterized by the presence of a second phosphotransferase-related domain immediately N-terminal to the PTK domain. The encoded kinase phosphorylates STAT proteins (signal transducers and activators of transcription) and plays a key role in interferon-alpha/beta and interferon-gamma signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for disruption of this gene die within the first 24 hours after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	A	T	11: 49,019,281	L775*	probably null	Het
Abcb8	A	G	5: 24,400,621	S168G	probably benign	Het
Ankrd11	A	G	8: 122,896,715		probably benign	Het
Api5	C	T	2: 94,425,613	R243Q	possibly damaging	Het
Atp8b1	A	G	18: 64,533,729		probably benign	Het
Camk2d	A	G	3: 126,771,839	D136G	probably damaging	Het
Capn3	G	A	2: 120,485,287	D227N	possibly damaging	Het
Cwf19l2	A	T	9: 3,456,803	H712L	probably benign	Het
Dlgap3	A	G	4: 127,195,606	T332A	probably damaging	Het
Eml6	C	A	11: 29,803,137	V925L	probably benign	Het
Fbll1	G	A	11: 35,797,678	H253Y	possibly damaging	Het
Fbxw18	T	A	9: 109,688,913	Y335F	possibly damaging	Het
Gbp10	T	A	5: 105,224,458	E145D	possibly damaging	Het
Gm8251	A	G	1: 44,058,866	V1024A	probably benign	Het
Ifi203	T	A	1: 173,929,474		probably benign	Het
Insig1	T	A	5: 28,071,703	I89N	probably damaging	Het
Itpkc	T	A	7: 27,227,604	D295V	possibly damaging	Het
Kctd9	G	A	14: 67,734,288	D157N	possibly damaging	Het
Kmt2c	A	C	5: 25,405,383	F242V	probably benign	Het
Lcorl	A	T	5: 45,734,041	N323K	possibly damaging	Het
Lin54	T	C	5: 100,459,806		probably benign	Het
Ltbp2	A	T	12: 84,804,474	C836S	probably damaging	Het
Mfsd2b	A	G	12: 4,870,578	S80P	probably damaging	Het
Myh9	G	A	15: 77,766,812	R1612C	probably damaging	Het
Nr1d2	T	A	14: 18,211,804	N433I	possibly damaging	Het
Olfr1217	T	C	2: 89,023,610	Y131C	probably damaging	Het
Olfr1385	A	G	11: 49,495,460	D309G	possibly damaging	Het
Olfr724	T	C	14: 49,960,556	N172S	possibly damaging	Het
Pld4	T	C	12: 112,768,035	I410T	probably benign	Het
Pnmal2	C	T	7: 16,946,596	H502Y	probably benign	Het
Pramef8	T	C	4: 143,416,642		probably benign	Het
Rbbp8nl	G	T	2: 180,281,248	T184K	probably benign	Het
Saa4	T	A	7: 46,729,629	N96Y	possibly damaging	Het
Serpinb6d	T	A	13: 33,667,680	V140E	probably damaging	Het
Ska3	A	T	14: 57,811,596	M306K	probably benign	Het
Slfn4	T	C	11: 83,185,311	M1T	probably null	Het
Sorcs1	T	C	19: 50,151,221	I1168V	probably benign	Het
Srsf4	C	T	4: 131,900,102		probably benign	Het
St18	G	A	1: 6,855,473		probably null	Het
Trim9	T	C	12: 70,251,195	T579A	probably damaging	Het
Trpc2	G	A	7: 102,084,504	S220N	probably damaging	Het
Ube2j1	A	T	4: 33,036,723	M16L	probably benign	Het
Usp42	C	T	5: 143,715,439	S943N	probably benign	Het
Utp20	C	T	10: 88,762,806	V103I	probably benign	Het
Vmn2r62	G	A	7: 42,787,887	P391L	probably benign	Het
Zfa-ps	T	A	10: 52,544,540		noncoding transcript	Het
Zfp423	A	G	8: 87,781,344	C666R	probably damaging	Het

Other mutations in Jak1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00906:Jak1	APN	4	101154629	missense	probably damaging	1.00
IGL00990:Jak1	APN	4	101171357	missense	probably damaging	1.00
IGL01341:Jak1	APN	4	101175093	missense	probably damaging	0.98
IGL02102:Jak1	APN	4	101159086	missense	probably benign	0.11
IGL02720:Jak1	APN	4	101164450	splice site	probably benign
IGL03301:Jak1	APN	4	101175173	missense	probably damaging	1.00
Back	UTSW	4	101174211	critical splice acceptor site	probably null
Behind	UTSW	4	101154537	critical splice donor site	probably null
Lady	UTSW	4	101179541	nonsense	probably null
BB006:Jak1	UTSW	4	101154645	missense	probably damaging	1.00
BB016:Jak1	UTSW	4	101154645	missense	probably damaging	1.00
PIT4377001:Jak1	UTSW	4	101179551	missense	probably benign	0.19
R0308:Jak1	UTSW	4	101154535	splice site	probably null
R0544:Jak1	UTSW	4	101191625	missense	probably benign
R1212:Jak1	UTSW	4	101189094	missense	probably damaging	1.00
R1519:Jak1	UTSW	4	101162922	missense	probably damaging	0.99
R1627:Jak1	UTSW	4	101191624	splice site	probably null
R1760:Jak1	UTSW	4	101162929	missense	probably benign	0.04
R2116:Jak1	UTSW	4	101179675	missense	probably damaging	0.98
R2980:Jak1	UTSW	4	101179781	missense	probably damaging	0.99
R3779:Jak1	UTSW	4	101156490	missense	probably benign	0.40
R4172:Jak1	UTSW	4	101159132	missense	probably benign	0.08
R4505:Jak1	UTSW	4	101154603	missense	probably benign
R4602:Jak1	UTSW	4	101179594	missense	possibly damaging	0.83
R4755:Jak1	UTSW	4	101174157	missense	probably damaging	1.00
R4836:Jak1	UTSW	4	101155066	missense	probably damaging	0.97
R4908:Jak1	UTSW	4	101179714	missense	probably damaging	1.00
R5116:Jak1	UTSW	4	101155113	missense	probably benign
R6190:Jak1	UTSW	4	101175128	missense	probably damaging	1.00
R6339:Jak1	UTSW	4	101161926	missense	probably damaging	0.99
R6500:Jak1	UTSW	4	101181933	missense	probably benign	0.43
R6551:Jak1	UTSW	4	101193843	start gained	probably benign
R6895:Jak1	UTSW	4	101154537	critical splice donor site	probably null
R7163:Jak1	UTSW	4	101175188	missense	probably damaging	1.00
R7204:Jak1	UTSW	4	101175135	missense	probably benign	0.02
R7361:Jak1	UTSW	4	101184339	missense	possibly damaging	0.86
R7408:Jak1	UTSW	4	101175182	missense	probably damaging	0.96
R7513:Jak1	UTSW	4	101191651	missense	probably damaging	0.96
R7617:Jak1	UTSW	4	101174211	critical splice acceptor site	probably null
R7779:Jak1	UTSW	4	101160142	missense	probably benign
R7929:Jak1	UTSW	4	101154645	missense	probably damaging	1.00
R8282:Jak1	UTSW	4	101179541	nonsense	probably null
Z1176:Jak1	UTSW	4	101163681	missense	probably damaging	1.00
Z1176:Jak1	UTSW	4	101163722	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GGGTCATTCCTTGGTATTCCAC -3'
(R):5'- AAGAGGACTGCAATGCCATG -3'

Sequencing Primer
(F):5'- CACAGCTGTCTTGTTAATGATAAGGG -3'
(R):5'- ACTGCAATGCCATGGCGTTC -3'

Posted On

2015-03-18